EMAIL THIS PAGE TO A FRIEND

SPG20

spastic paraplegia 20 (Troyer syndrome)

Synonyms: SPARTIN TAHCCP1
UniProtKB ID: Q8N0X7, O60349, Q86Y67, Q9H1T2, Q9H1T3
Gene ID:
Human(23111) Summary: This gene encodes a protein containing a MIT (Microtubule Interacting and Trafficking molecule) domain, and is implicated in regulating endosomal trafficking and mitochondria function. The protein localizes to mitochondria and partially co-localizes with microtubules. Stimulation with epidermal growth factor (EGF) results in protein translocation to the plasma membrane, and the protein functions in the degradation and intracellular trafficking of EGF receptor. Multiple alternatively spliced variants, encoding the same protein, have been identified. Mutations associated with this gene cause autosomal recessive spastic paraplegia 20 (Troyer syndrome). [provided by RefSeq, Nov 2008]
Mouse(229285) spastic paraplegia 20, spartin (Troyer syndrome) homolog (human)
Rat(295053) spastic paraplegia 20 (Troyer syndrome)
chicken(418902) spastic paraplegia 20 (Troyer syndrome)
dog(477303) spastic paraplegia 20 (Troyer syndrome)
domestic cat(101085013) spastic paraplegia 20 (Troyer syndrome)
Horse(100062426) spastic paraplegia 20 (Troyer syndrome)
cow(534027) spastic paraplegia 20 (Troyer syndrome)
sheep(101105830) spastic paraplegia 20 (Troyer syndrome)
Domestic Rabbit(100358128) spastic paraplegia 20 (Troyer syndrome)
naked mole-rat(101721028) spastic paraplegia 20 (Troyer syndrome)
domestic guinea pig(100726150) spastic paraplegia 20 (Troyer syndrome)
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015087 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015087 Rosetta Predictions human pricing
NM_001106433 Rosetta Predictions rat pricing
NM_144895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145653 predicted 1880
2 SASI_Hs01_00145654 predicted 1216
3 SASI_Hs01_00145655 predicted 1640
4 SASI_Hs02_00346965 predicted 1570
5 SASI_Hs01_00145657 predicted 1767
6 SASI_Hs01_00145658 predicted 1915
7 SASI_Hs01_00145659 predicted 1814
8 SASI_Hs02_00346966 predicted 1586
9 SASI_Hs01_00145660 predicted 1581
10 SASI_Hs02_00346967 predicted 2119
11 SASI_Hs01_00145656 predicted 1754
12 SASI_Hs01_00145661 predicted 1283
13 SASI_Hs01_00145662 predicted 2162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218918 predicted 747
2 SASI_Rn02_00218919 predicted 1611
3 SASI_Rn02_00218920 predicted 1421
4 SASI_Rn02_00218921 predicted 1657
5 SASI_Rn02_00218922 predicted 835
6 SASI_Rn02_00218923 predicted 1370
7 SASI_Rn02_00218924 predicted 1625
8 SASI_Rn02_00218925 predicted 673
9 SASI_Rn02_00218926 predicted 443
10 SASI_Rn02_00218927 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086321 predicted 840
2 SASI_Mm01_00086322 predicted 1348
3 SASI_Mm01_00086323 predicted 1763
4 SASI_Mm01_00086324 predicted 1139
5 SASI_Mm01_00086325 predicted 431
6 SASI_Mm01_00086326 predicted 1860
7 SASI_Mm01_00086327 predicted 191
8 SASI_Mm01_00086328 predicted 2121
9 SASI_Mm01_00086329 predicted 663
10 SASI_Mm01_00086330 predicted 1752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015087
VALIDATED
SPG20 MISSION shRNA Bacterial Glycerol Stock
spastic paraplegia 20 (Troyer syndrome)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-2077s21c1
Sequence:CCGGTTGGCGTAACTGCCTACAATACTCGAGTATTGTAGGCAGTTACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-1900s21c1
Sequence:CCGGCTATGGTTGTAGCAGCAAGTACTCGAGTACTTGCTGCTACAACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015087.4-2317s21c1
Sequence:CCGGGCCTTATGAAATGGATGAAATCTCGAGATTTCATCCATTTCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-507s21c1
Sequence:CCGGGCTAGACAGATGCAACAGAAACTCGAGTTTCTGTTGCATCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-1914s21c1
Sequence:CCGGGCAAGTAGTGTTCAAGGATTTCTCGAGAAATCCTTGAACACTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-2124s1c1
Sequence:CCGGGCCTTATGAAATGGATGAAATCTCGAGATTTCATCCATTTCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-1721s1c1
Sequence:CCGGGCAAGTAGTGTTCAAGGATTTCTCGAGAAATCCTTGAACACTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-1707s1c1
Sequence:CCGGCTATGGTTGTAGCAGCAAGTACTCGAGTACTTGCTGCTACAACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015087.3-314s1c1
Sequence:CCGGGCTAGACAGATGCAACAGAAACTCGAGTTTCTGTTGCATCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-425s1c1
Sequence:CCGGCCCAAGTTATATCCAGAATTTCTCGAGAAATTCTGGATATAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015087
VALIDATED
SPG20 MISSION shRNA shRNA Plasmid DNA
spastic paraplegia 20 (Troyer syndrome)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-2077s21c1
Sequence:CCGGTTGGCGTAACTGCCTACAATACTCGAGTATTGTAGGCAGTTACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-1900s21c1
Sequence:CCGGCTATGGTTGTAGCAGCAAGTACTCGAGTACTTGCTGCTACAACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015087.4-2317s21c1
Sequence:CCGGGCCTTATGAAATGGATGAAATCTCGAGATTTCATCCATTTCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-507s21c1
Sequence:CCGGGCTAGACAGATGCAACAGAAACTCGAGTTTCTGTTGCATCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-1914s21c1
Sequence:CCGGGCAAGTAGTGTTCAAGGATTTCTCGAGAAATCCTTGAACACTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-2124s1c1
Sequence:CCGGGCCTTATGAAATGGATGAAATCTCGAGATTTCATCCATTTCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-1721s1c1
Sequence:CCGGGCAAGTAGTGTTCAAGGATTTCTCGAGAAATCCTTGAACACTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-1707s1c1
Sequence:CCGGCTATGGTTGTAGCAGCAAGTACTCGAGTACTTGCTGCTACAACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015087.3-314s1c1
Sequence:CCGGGCTAGACAGATGCAACAGAAACTCGAGTTTCTGTTGCATCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-425s1c1
Sequence:CCGGCCCAAGTTATATCCAGAATTTCTCGAGAAATTCTGGATATAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015087
VALIDATED
SPG20 MISSION shRNA Lentiviral Transduction Particles
spastic paraplegia 20 (Troyer syndrome)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-2077s21c1
Sequence:CCGGTTGGCGTAACTGCCTACAATACTCGAGTATTGTAGGCAGTTACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-1900s21c1
Sequence:CCGGCTATGGTTGTAGCAGCAAGTACTCGAGTACTTGCTGCTACAACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015087.4-2317s21c1
Sequence:CCGGGCCTTATGAAATGGATGAAATCTCGAGATTTCATCCATTTCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-507s21c1
Sequence:CCGGGCTAGACAGATGCAACAGAAACTCGAGTTTCTGTTGCATCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015087.4-1914s21c1
Sequence:CCGGGCAAGTAGTGTTCAAGGATTTCTCGAGAAATCCTTGAACACTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-2124s1c1
Sequence:CCGGGCCTTATGAAATGGATGAAATCTCGAGATTTCATCCATTTCATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-1721s1c1
Sequence:CCGGGCAAGTAGTGTTCAAGGATTTCTCGAGAAATCCTTGAACACTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-1707s1c1
Sequence:CCGGCTATGGTTGTAGCAGCAAGTACTCGAGTACTTGCTGCTACAACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015087.3-314s1c1
Sequence:CCGGGCTAGACAGATGCAACAGAAACTCGAGTTTCTGTTGCATCTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015087.3-425s1c1
Sequence:CCGGCCCAAGTTATATCCAGAATTTCTCGAGAAATTCTGGATATAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144895
VALIDATED
SPG20 MISSION shRNA Bacterial Glycerol Stock
spastic paraplegia 20 (Troyer syndrome)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144895.1-829s21c1
Sequence:CCGGTCGTGCGGTTCTTGGATAATTCTCGAGAATTATCCAAGAACCGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-169s21c1
Sequence:CCGGGACTGAACACGGACGAGTTAGCTCGAGCTAACTCGTCCGTGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-2174s21c1
Sequence:CCGGGCGTCTTCTGTCTGTTCATTTCTCGAGAAATGAACAGACAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144895.1-1882s21c1
Sequence:CCGGTTGGGCTCACTGCCTACAATACTCGAGTATTGTAGGCAGTGAGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-888s21c1
Sequence:CCGGCAGGTGTGTGACTGGTTATACCTCGAGGTATAACCAGTCACACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144895.1-1596s1c1
Sequence:CCGGGCGAATTGTGTTGGTAAAGAACTCGAGTTCTTTACCAACACAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144895.1-2174s1c1
Sequence:CCGGGCGTCTTCTGTCTGTTCATTTCTCGAGAAATGAACAGACAGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144895.1-2169s1c1
Sequence:CCGGGAACAGCGTCTTCTGTCTGTTCTCGAGAACAGACAGAAGACGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144895
VALIDATED
SPG20 MISSION shRNA shRNA Plasmid DNA
spastic paraplegia 20 (Troyer syndrome)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144895.1-829s21c1
Sequence:CCGGTCGTGCGGTTCTTGGATAATTCTCGAGAATTATCCAAGAACCGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-169s21c1
Sequence:CCGGGACTGAACACGGACGAGTTAGCTCGAGCTAACTCGTCCGTGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-2174s21c1
Sequence:CCGGGCGTCTTCTGTCTGTTCATTTCTCGAGAAATGAACAGACAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144895.1-1882s21c1
Sequence:CCGGTTGGGCTCACTGCCTACAATACTCGAGTATTGTAGGCAGTGAGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-888s21c1
Sequence:CCGGCAGGTGTGTGACTGGTTATACCTCGAGGTATAACCAGTCACACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144895.1-1596s1c1
Sequence:CCGGGCGAATTGTGTTGGTAAAGAACTCGAGTTCTTTACCAACACAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144895.1-2174s1c1
Sequence:CCGGGCGTCTTCTGTCTGTTCATTTCTCGAGAAATGAACAGACAGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144895.1-2169s1c1
Sequence:CCGGGAACAGCGTCTTCTGTCTGTTCTCGAGAACAGACAGAAGACGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144895
VALIDATED
SPG20 MISSION shRNA Lentiviral Transduction Particles
spastic paraplegia 20 (Troyer syndrome)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144895.1-829s21c1
Sequence:CCGGTCGTGCGGTTCTTGGATAATTCTCGAGAATTATCCAAGAACCGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-169s21c1
Sequence:CCGGGACTGAACACGGACGAGTTAGCTCGAGCTAACTCGTCCGTGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-2174s21c1
Sequence:CCGGGCGTCTTCTGTCTGTTCATTTCTCGAGAAATGAACAGACAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144895.1-1882s21c1
Sequence:CCGGTTGGGCTCACTGCCTACAATACTCGAGTATTGTAGGCAGTGAGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144895.1-888s21c1
Sequence:CCGGCAGGTGTGTGACTGGTTATACCTCGAGGTATAACCAGTCACACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144895.1-1596s1c1
Sequence:CCGGGCGAATTGTGTTGGTAAAGAACTCGAGTTCTTTACCAACACAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144895.1-2174s1c1
Sequence:CCGGGCGTCTTCTGTCTGTTCATTTCTCGAGAAATGAACAGACAGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144895.1-2169s1c1
Sequence:CCGGGAACAGCGTCTTCTGTCTGTTCTCGAGAACAGACAGAAGACGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks