EMAIL THIS PAGE TO A FRIEND

SPG21

spastic paraplegia 21 (autosomal recessive, Mast syndrome)

Synonyms: ACP33 GL010 MAST
UniProtKB ID: Q9NZD8, B4DW44, Q6ZMB6
Gene ID:
Human(51324) Summary: The protein encoded by this gene was identified by a two-hybrid screen using CD4 as the bait. It binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation. The interaction with CD4 is mediated by the noncatalytic alpha/beta hydrolase fold domain of this protein. It is thus proposed that this gene product modulates the stimulatory activity of CD4. At least three different transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(27965) spastic paraplegia 21 homolog (human)
Rat(300791) spastic paraplegia 21 homolog (human)
Zebrafish(406704) spastic paraplegia 21 (H. sapiens)
chicken(415526) spastic paraplegia 21 (autosomal recessive, Mast syndrome)
domestic cat(101096987) spastic paraplegia 21 (autosomal recessive, Mast syndrome)
dog(487599) spastic paraplegia 21 (autosomal recessive, Mast syndrome)
domestic guinea pig(100713790) spastic paraplegia 21 (autosomal recessive, Mast syndrome)
naked mole-rat(101696663) spastic paraplegia 21 (autosomal recessive, Mast syndrome)
cow(404069) spastic paraplegia 21 (autosomal recessive, Mast syndrome)
sheep(101117420) spastic paraplegia 21 (autosomal recessive, Mast syndrome)
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016630 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127889 Rosetta Predictions human pricing
NM_001127890 Rosetta Predictions human pricing
NM_016630 Rosetta Predictions human pricing
NM_001006987 Rosetta Predictions rat pricing
XM_001076606 Rosetta Predictions rat pricing
NM_138584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330384 predicted 306
2 SASI_Hs02_00330385 predicted 1049
3 SASI_Hs02_00330386 predicted 741
4 SASI_Hs02_00330387 predicted 374
5 SASI_Hs02_00330388 predicted 475
6 SASI_Hs02_00330389 predicted 748
7 SASI_Hs02_00330390 predicted 666
8 SASI_Hs02_00330391 predicted 805
9 SASI_Hs02_00330392 predicted 207
10 SASI_Hs02_00330393 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330394 predicted 481
2 SASI_Hs02_00330395 predicted 838
3 SASI_Hs02_00330396 predicted 580
4 SASI_Hs02_00330397 predicted 830
5 SASI_Hs02_00330398 predicted 843
6 SASI_Hs02_00330399 predicted 762
7 SASI_Hs02_00330400 predicted 902
8 SASI_Hs02_00330401 predicted 390
9 SASI_Hs02_00330402 predicted 351
10 SASI_Hs02_00330403 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034784 predicted 486
2 SASI_Hs01_00034785 predicted 1224
3 SASI_Hs01_00034788 predicted 924
4 SASI_Hs01_00034789 predicted 558
5 SASI_Hs01_00034790 predicted 660
6 SASI_Hs01_00034791 predicted 930
7 SASI_Hs01_00034793 predicted 843
8 SASI_Hs02_00349793 predicted 984
9 SASI_Hs02_00349794 predicted 385
10 SASI_Hs02_00349795 predicted 487
11 SASI_Hs01_00034786 predicted 1034
12 SASI_Hs01_00034787 predicted 864
13 SASI_Hs01_00034792 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102549 predicted 424
2 SASI_Rn01_00102550 predicted 498
3 SASI_Rn01_00102551 predicted 805
4 SASI_Rn01_00102552 predicted 656
5 SASI_Rn01_00102554 predicted 837
6 SASI_Rn01_00102555 predicted 1079
7 SASI_Rn02_00198561 predicted 803
8 SASI_Rn01_00102556 predicted 802
9 SASI_Rn01_00102557 predicted 1086
10 SASI_Rn02_00198562 predicted 437
11 SASI_Rn01_00102553 predicted 471
12 SASI_Rn01_00102558 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353863 predicted 345
2 SASI_Rn02_00353864 predicted 232
3 SASI_Rn02_00353865 predicted 407
4 SASI_Rn02_00353866 predicted 624
5 SASI_Rn02_00353867 predicted 649
6 SASI_Rn02_00353868 predicted 340
7 SASI_Rn02_00353869 predicted 1044
8 SASI_Rn02_00353870 predicted 299
9 SASI_Rn02_00353871 predicted 771
10 SASI_Rn02_00353872 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103345 predicted 245
2 SASI_Mm01_00103346 predicted 531
3 SASI_Mm01_00103347 predicted 832
4 SASI_Mm01_00103348 predicted 760
5 SASI_Mm01_00103349 predicted 248
6 SASI_Mm01_00103350 predicted 1258
7 SASI_Mm01_00103351 predicted 455
8 SASI_Mm01_00103352 predicted 985
9 SASI_Mm01_00103353 predicted 459
10 SASI_Mm02_00339638 predicted 1261
11 SASI_Mm01_00103344 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016630
VALIDATED
SPG21 MISSION shRNA Bacterial Glycerol Stock
spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-916s1c1
Sequence:CCGGCGGGACATACCTGTAACTATTCTCGAGAATAGTTACAGGTATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016630.3-1372s1c1
Sequence:CCGGCCTGTGTAACTGTTCCCTCTTCTCGAGAAGAGGGAACAGTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-862s1c1
Sequence:CCGGGCTTCAAGACTTACCTTGAATCTCGAGATTCAAGGTAAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-497s1c1
Sequence:CCGGCTTTGCAGTATCCAGTTTATTCTCGAGAATAAACTGGATACTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-863s1c1
Sequence:CCGGCTTCAAGACTTACCTTGAATTCTCGAGAATTCAAGGTAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-1372s21c1
Sequence:CCGGCCTGTGTAACTGTTCCCTCTTCTCGAGAAGAGGGAACAGTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-396s21c1
Sequence:CCGGTATCAGGTGTCCTCTCATATTCTCGAGAATATGAGAGGACACCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-347s21c1
Sequence:CCGGATGATGATGACAGTAAGATATCTCGAGATATCTTACTGTCATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-559s21c1
Sequence:CCGGGACCATTTACAATTGGATAAACTCGAGTTTATCCAATTGTAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-863s21c1
Sequence:CCGGCTTCAAGACTTACCTTGAATTCTCGAGAATTCAAGGTAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016630
VALIDATED
SPG21 MISSION shRNA shRNA Plasmid DNA
spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-916s1c1
Sequence:CCGGCGGGACATACCTGTAACTATTCTCGAGAATAGTTACAGGTATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016630.3-1372s1c1
Sequence:CCGGCCTGTGTAACTGTTCCCTCTTCTCGAGAAGAGGGAACAGTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-862s1c1
Sequence:CCGGGCTTCAAGACTTACCTTGAATCTCGAGATTCAAGGTAAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-497s1c1
Sequence:CCGGCTTTGCAGTATCCAGTTTATTCTCGAGAATAAACTGGATACTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-863s1c1
Sequence:CCGGCTTCAAGACTTACCTTGAATTCTCGAGAATTCAAGGTAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-1372s21c1
Sequence:CCGGCCTGTGTAACTGTTCCCTCTTCTCGAGAAGAGGGAACAGTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-396s21c1
Sequence:CCGGTATCAGGTGTCCTCTCATATTCTCGAGAATATGAGAGGACACCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-347s21c1
Sequence:CCGGATGATGATGACAGTAAGATATCTCGAGATATCTTACTGTCATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-559s21c1
Sequence:CCGGGACCATTTACAATTGGATAAACTCGAGTTTATCCAATTGTAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-863s21c1
Sequence:CCGGCTTCAAGACTTACCTTGAATTCTCGAGAATTCAAGGTAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016630
VALIDATED
SPG21 MISSION shRNA Lentiviral Transduction Particles
spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-916s1c1
Sequence:CCGGCGGGACATACCTGTAACTATTCTCGAGAATAGTTACAGGTATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016630.3-1372s1c1
Sequence:CCGGCCTGTGTAACTGTTCCCTCTTCTCGAGAAGAGGGAACAGTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-862s1c1
Sequence:CCGGGCTTCAAGACTTACCTTGAATCTCGAGATTCAAGGTAAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-497s1c1
Sequence:CCGGCTTTGCAGTATCCAGTTTATTCTCGAGAATAAACTGGATACTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016630.3-863s1c1
Sequence:CCGGCTTCAAGACTTACCTTGAATTCTCGAGAATTCAAGGTAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-1372s21c1
Sequence:CCGGCCTGTGTAACTGTTCCCTCTTCTCGAGAAGAGGGAACAGTTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-396s21c1
Sequence:CCGGTATCAGGTGTCCTCTCATATTCTCGAGAATATGAGAGGACACCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-347s21c1
Sequence:CCGGATGATGATGACAGTAAGATATCTCGAGATATCTTACTGTCATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-559s21c1
Sequence:CCGGGACCATTTACAATTGGATAAACTCGAGTTTATCCAATTGTAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016630.3-863s21c1
Sequence:CCGGCTTCAAGACTTACCTTGAATTCTCGAGAATTCAAGGTAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138584
VALIDATED
SPG21 MISSION shRNA Bacterial Glycerol Stock
spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192205    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138584.1-1226s1c1
Sequence:CCGGCGTACTGATTGTCAATCTCATCTCGAGATGAGATTGACAATCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138584.1-806s1c1
Sequence:CCGGGCTAACTCTCAACTGTCAGAACTCGAGTTCTGACAGTTGAGAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189530    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138584.1-1161s1c1
Sequence:CCGGCCTGCTCTTGCACAATCAGTTCTCGAGAACTGATTGTGCAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138584.2-1027s1c1
Sequence:CCGGGTGCAGAGGTCAATCTTTATGCTCGAGCATAAAGATTGACCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-803s21c1
Sequence:CCGGGCTGGAGAGTTTGGGTCAAAGCTCGAGCTTTGACCCAAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138584.2-2111s21c1
Sequence:CCGGCCTATCCTGGATGGCTATAAACTCGAGTTTATAGCCATCCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-648s21c1
Sequence:CCGGGCCTTCAGTGACACGTCTATCCTCGAGGATAGACGTGTCACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-697s21c1
Sequence:CCGGTCTGGTTGATGCCAGCGTTTACTCGAGTAAACGCTGGCATCAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-955s21c1
Sequence:CCGGTGTACAAACTGTACCCTAATGCTCGAGCATTAGGGTACAGTTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138584
VALIDATED
SPG21 MISSION shRNA shRNA Plasmid DNA
spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192205    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138584.1-1226s1c1
Sequence:CCGGCGTACTGATTGTCAATCTCATCTCGAGATGAGATTGACAATCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138584.1-806s1c1
Sequence:CCGGGCTAACTCTCAACTGTCAGAACTCGAGTTCTGACAGTTGAGAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189530    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138584.1-1161s1c1
Sequence:CCGGCCTGCTCTTGCACAATCAGTTCTCGAGAACTGATTGTGCAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138584.2-1027s1c1
Sequence:CCGGGTGCAGAGGTCAATCTTTATGCTCGAGCATAAAGATTGACCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-803s21c1
Sequence:CCGGGCTGGAGAGTTTGGGTCAAAGCTCGAGCTTTGACCCAAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138584.2-2111s21c1
Sequence:CCGGCCTATCCTGGATGGCTATAAACTCGAGTTTATAGCCATCCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-648s21c1
Sequence:CCGGGCCTTCAGTGACACGTCTATCCTCGAGGATAGACGTGTCACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-697s21c1
Sequence:CCGGTCTGGTTGATGCCAGCGTTTACTCGAGTAAACGCTGGCATCAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-955s21c1
Sequence:CCGGTGTACAAACTGTACCCTAATGCTCGAGCATTAGGGTACAGTTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138584
VALIDATED
SPG21 MISSION shRNA Lentiviral Transduction Particles
spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192205    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138584.1-1226s1c1
Sequence:CCGGCGTACTGATTGTCAATCTCATCTCGAGATGAGATTGACAATCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138584.1-806s1c1
Sequence:CCGGGCTAACTCTCAACTGTCAGAACTCGAGTTCTGACAGTTGAGAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189530    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138584.1-1161s1c1
Sequence:CCGGCCTGCTCTTGCACAATCAGTTCTCGAGAACTGATTGTGCAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138584.2-1027s1c1
Sequence:CCGGGTGCAGAGGTCAATCTTTATGCTCGAGCATAAAGATTGACCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-803s21c1
Sequence:CCGGGCTGGAGAGTTTGGGTCAAAGCTCGAGCTTTGACCCAAACTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138584.2-2111s21c1
Sequence:CCGGCCTATCCTGGATGGCTATAAACTCGAGTTTATAGCCATCCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-648s21c1
Sequence:CCGGGCCTTCAGTGACACGTCTATCCTCGAGGATAGACGTGTCACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-697s21c1
Sequence:CCGGTCTGGTTGATGCCAGCGTTTACTCGAGTAAACGCTGGCATCAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138584.2-955s21c1
Sequence:CCGGTGTACAAACTGTACCCTAATGCTCGAGCATTAGGGTACAGTTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks