EMAIL THIS PAGE TO A FRIEND

SPG7

spastic paraplegia 7 (pure and complicated autosomal recessive)

Synonyms: CAR CMAR PGN SPG5C
UniProtKB ID: Q9UQ90, O75756, Q2TB70, Q58F00, Q96IB0
Gene ID:
Human(6687) Summary: This gene encodes a nuclear-encoded mitochondrial metalloprotease protein that is a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 7. [provided by RefSeq, Jul 2008]
Mouse(234847) spastic paraplegia 7 homolog (human)
Rat(353231) spastic paraplegia 7 homolog (human)
Zebrafish(794740) spastic paraplegia 7
chicken(415843) spastic paraplegia 7 (pure and complicated autosomal recessive)
domestic cat(101100685) spastic paraplegia 7 (pure and complicated autosomal recessive)
Horse(100051955) spastic paraplegia 7 (pure and complicated autosomal recessive)
dog(489657) spastic paraplegia 7 (pure and complicated autosomal recessive)
cow(515269) spastic paraplegia 7 (pure and complicated autosomal recessive)
sheep(101110441) spastic paraplegia 7 (pure and complicated autosomal recessive)
naked mole-rat(101704059) spastic paraplegia 7 (pure and complicated autosomal recessive)
Domestic Rabbit(100342856) spastic paraplegia 7 (pure and complicated autosomal recessive)
domestic guinea pig(100730673) spastic paraplegia 7 (pure and complicated autosomal recessive)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003119 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003119 Rosetta Predictions human pricing
NM_199367 Rosetta Predictions human pricing
NM_181388 Rosetta Predictions rat pricing
NM_153176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218721 predicted 738
2 SASI_Hs01_00218722 predicted 650
3 SASI_Hs01_00218723 predicted 753
4 SASI_Hs01_00218724 predicted 985
5 SASI_Hs01_00218725 predicted 743
6 SASI_Hs01_00218726 predicted 653
7 SASI_Hs01_00218727 predicted 982
8 SASI_Hs01_00218728 predicted 960
9 SASI_Hs01_00218729 predicted 926
10 SASI_Hs01_00218730 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246781 predicted 737
2 SASI_Hs01_00246782 predicted 656
3 SASI_Hs01_00246783 predicted 750
4 SASI_Hs01_00246784 predicted 987
5 SASI_Hs01_00246785 predicted 749
6 SASI_Hs01_00246786 predicted 655
7 SASI_Hs01_00246787 predicted 980
8 SASI_Hs01_00246788 predicted 955
9 SASI_Hs01_00246789 predicted 924
10 SASI_Hs01_00246790 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090127 predicted 610
2 SASI_Rn01_00090128 predicted 1587
3 SASI_Rn01_00090129 predicted 277
4 SASI_Rn01_00090130 predicted 472
5 SASI_Rn01_00090131 predicted 1176
6 SASI_Rn01_00090132 predicted 293
7 SASI_Rn01_00090133 predicted 278
8 SASI_Rn01_00090134 predicted 1713
9 SASI_Rn01_00090135 predicted 1592
10 SASI_Rn01_00090136 predicted 2149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189059 predicted 748
2 SASI_Mm01_00189060 predicted 978
3 SASI_Mm01_00189061 predicted 247
4 SASI_Mm01_00189062 predicted 983
5 SASI_Mm01_00189063 predicted 224
6 SASI_Mm02_00343101 predicted 505
7 SASI_Mm01_00189064 predicted 1669
8 SASI_Mm01_00189065 predicted 260
9 SASI_Mm01_00189067 predicted 1666
10 SASI_Mm02_00343102 predicted 1984
11 SASI_Mm01_00189066 predicted 1558
12 SASI_Mm01_00189068 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003119
VALIDATED
SPG7 MISSION shRNA Bacterial Glycerol Stock
spastic paraplegia 7 (pure and complicated autosomal recessive)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-759s21c1
Sequence:CCGGGCGAACAGGATTCTTTGGAAACTCGAGTTTCCAAAGAATCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003119.2-2670s21c1
Sequence:CCGGCTTCGAGTTCCCAGGGTTATACTCGAGTATAACCCTGGGAACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003119.2-1641s21c1
Sequence:CCGGGCACACTCTCAACTTCGAGTACTCGAGTACTCGAAGTTGAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-228s21c1
Sequence:CCGGCCCTACCTTTGAAGGGATCAACTCGAGTTGATCCCTTCAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-2242s21c1
Sequence:CCGGGAGGACATTGAGGCTCTCATTCTCGAGAATGAGAGCCTCAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-1641s1c1
Sequence:CCGGGCACACTCTCAACTTCGAGTACTCGAGTACTCGAAGTTGAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-2242s1c1
Sequence:CCGGGAGGACATTGAGGCTCTCATTCTCGAGAATGAGAGCCTCAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-759s1c1
Sequence:CCGGGCGAACAGGATTCTTTGGAAACTCGAGTTTCCAAAGAATCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-228s1c1
Sequence:CCGGCCCTACCTTTGAAGGGATCAACTCGAGTTGATCCCTTCAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-1789s1c1
Sequence:CCGGGCCGTGATGAAGGTCTCCATACTCGAGTATGGAGACCTTCATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003119
VALIDATED
SPG7 MISSION shRNA shRNA Plasmid DNA
spastic paraplegia 7 (pure and complicated autosomal recessive)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-759s21c1
Sequence:CCGGGCGAACAGGATTCTTTGGAAACTCGAGTTTCCAAAGAATCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003119.2-2670s21c1
Sequence:CCGGCTTCGAGTTCCCAGGGTTATACTCGAGTATAACCCTGGGAACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003119.2-1641s21c1
Sequence:CCGGGCACACTCTCAACTTCGAGTACTCGAGTACTCGAAGTTGAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-228s21c1
Sequence:CCGGCCCTACCTTTGAAGGGATCAACTCGAGTTGATCCCTTCAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-2242s21c1
Sequence:CCGGGAGGACATTGAGGCTCTCATTCTCGAGAATGAGAGCCTCAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-1641s1c1
Sequence:CCGGGCACACTCTCAACTTCGAGTACTCGAGTACTCGAAGTTGAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-2242s1c1
Sequence:CCGGGAGGACATTGAGGCTCTCATTCTCGAGAATGAGAGCCTCAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-759s1c1
Sequence:CCGGGCGAACAGGATTCTTTGGAAACTCGAGTTTCCAAAGAATCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-228s1c1
Sequence:CCGGCCCTACCTTTGAAGGGATCAACTCGAGTTGATCCCTTCAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-1789s1c1
Sequence:CCGGGCCGTGATGAAGGTCTCCATACTCGAGTATGGAGACCTTCATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003119
VALIDATED
SPG7 MISSION shRNA Lentiviral Transduction Particles
spastic paraplegia 7 (pure and complicated autosomal recessive)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-759s21c1
Sequence:CCGGGCGAACAGGATTCTTTGGAAACTCGAGTTTCCAAAGAATCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003119.2-2670s21c1
Sequence:CCGGCTTCGAGTTCCCAGGGTTATACTCGAGTATAACCCTGGGAACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003119.2-1641s21c1
Sequence:CCGGGCACACTCTCAACTTCGAGTACTCGAGTACTCGAAGTTGAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-228s21c1
Sequence:CCGGCCCTACCTTTGAAGGGATCAACTCGAGTTGATCCCTTCAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003119.2-2242s21c1
Sequence:CCGGGAGGACATTGAGGCTCTCATTCTCGAGAATGAGAGCCTCAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-1641s1c1
Sequence:CCGGGCACACTCTCAACTTCGAGTACTCGAGTACTCGAAGTTGAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-2242s1c1
Sequence:CCGGGAGGACATTGAGGCTCTCATTCTCGAGAATGAGAGCCTCAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-759s1c1
Sequence:CCGGGCGAACAGGATTCTTTGGAAACTCGAGTTTCCAAAGAATCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-228s1c1
Sequence:CCGGCCCTACCTTTGAAGGGATCAACTCGAGTTGATCCCTTCAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003119.2-1789s1c1
Sequence:CCGGGCCGTGATGAAGGTCTCCATACTCGAGTATGGAGACCTTCATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153176
VALIDATED
SPG7 MISSION shRNA Bacterial Glycerol Stock
spastic paraplegia 7 (pure and complicated autosomal recessive)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000031204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153176.3-1087s1c1
Sequence:CCGGCGGACAGGATTCTTTGGGAATCTCGAGATTCCCAAAGAATCCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-1552s1c1
Sequence:CCGGCCTTGCATAGTGTACATTGATCTCGAGATCAATGTACACTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-2623s1c1
Sequence:CCGGGCACCACAGAAATGGATTGATCTCGAGATCAATCCATTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-560s1c1
Sequence:CCGGGCTTTGAAGGTATTAGCGGATCTCGAGATCCGCTAATACCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153176
VALIDATED
SPG7 MISSION shRNA shRNA Plasmid DNA
spastic paraplegia 7 (pure and complicated autosomal recessive)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000031204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153176.3-1087s1c1
Sequence:CCGGCGGACAGGATTCTTTGGGAATCTCGAGATTCCCAAAGAATCCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-1552s1c1
Sequence:CCGGCCTTGCATAGTGTACATTGATCTCGAGATCAATGTACACTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-2623s1c1
Sequence:CCGGGCACCACAGAAATGGATTGATCTCGAGATCAATCCATTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-560s1c1
Sequence:CCGGGCTTTGAAGGTATTAGCGGATCTCGAGATCCGCTAATACCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153176
VALIDATED
SPG7 MISSION shRNA Lentiviral Transduction Particles
spastic paraplegia 7 (pure and complicated autosomal recessive)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000031204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153176.3-1087s1c1
Sequence:CCGGCGGACAGGATTCTTTGGGAATCTCGAGATTCCCAAAGAATCCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-1552s1c1
Sequence:CCGGCCTTGCATAGTGTACATTGATCTCGAGATCAATGTACACTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-2623s1c1
Sequence:CCGGGCACCACAGAAATGGATTGATCTCGAGATCAATCCATTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153176.3-560s1c1
Sequence:CCGGGCTTTGAAGGTATTAGCGGATCTCGAGATCCGCTAATACCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks