EMAIL THIS PAGE TO A FRIEND

SPHAR

S-phase response (cyclin related)

Synonyms: RP4-803J11.4
UniProtKB ID: Q15513, Q4EW09, Q6NSB9
Gene ID:
cow(101907612) S-phase response (cyclin related)
sheep(101123439) S-phase response (cyclin related)
dog(100683113) S-phase response (cyclin related)
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006542 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006542 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171979 predicted 759
2 SASI_Hs02_00341804 predicted 866
3 SASI_Hs01_00171981 predicted 850
4 SASI_Hs01_00171982 predicted 867
5 SASI_Hs01_00171983 predicted 865
6 SASI_Hs01_00171984 predicted 850
7 SASI_Hs01_00171985 predicted 842
8 SASI_Hs01_00171986 predicted 833
9 SASI_Hs01_00171987 predicted 846
10 SASI_Hs02_00341805 predicted 853
11 SASI_Hs01_00171980 predicted 703
12 SASI_Hs01_00171988 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006542
VALIDATED
SPHAR MISSION shRNA Bacterial Glycerol Stock
S-phase response (cyclin related)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-695s1c1
Sequence:CCGGGAAGCAAATTCTCAGACTGAACTCGAGTTCAGTCTGAGAATTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-712s1c1
Sequence:CCGGTGAACTACTTCTTAGACCTCACTCGAGTGAGGTCTAAGAAGTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-769s1c1
Sequence:CCGGAGATTTGCAAGCTGCTCATTTCTCGAGAAATGAGCAGCTTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-722s1c1
Sequence:CCGGCTTAGACCTCACTGTAAGAATCTCGAGATTCTTACAGTGAGGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-704s1c1
Sequence:CCGGTCTCAGACTGAACTACTTCTTCTCGAGAAGAAGTAGTTCAGTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006542
VALIDATED
SPHAR MISSION shRNA shRNA Plasmid DNA
S-phase response (cyclin related)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-695s1c1
Sequence:CCGGGAAGCAAATTCTCAGACTGAACTCGAGTTCAGTCTGAGAATTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-712s1c1
Sequence:CCGGTGAACTACTTCTTAGACCTCACTCGAGTGAGGTCTAAGAAGTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-769s1c1
Sequence:CCGGAGATTTGCAAGCTGCTCATTTCTCGAGAAATGAGCAGCTTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-722s1c1
Sequence:CCGGCTTAGACCTCACTGTAAGAATCTCGAGATTCTTACAGTGAGGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-704s1c1
Sequence:CCGGTCTCAGACTGAACTACTTCTTCTCGAGAAGAAGTAGTTCAGTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006542
VALIDATED
SPHAR MISSION shRNA Lentiviral Transduction Particles
S-phase response (cyclin related)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-695s1c1
Sequence:CCGGGAAGCAAATTCTCAGACTGAACTCGAGTTCAGTCTGAGAATTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-712s1c1
Sequence:CCGGTGAACTACTTCTTAGACCTCACTCGAGTGAGGTCTAAGAAGTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-769s1c1
Sequence:CCGGAGATTTGCAAGCTGCTCATTTCTCGAGAAATGAGCAGCTTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-722s1c1
Sequence:CCGGCTTAGACCTCACTGTAAGAATCTCGAGATTCTTACAGTGAGGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006542.2-704s1c1
Sequence:CCGGTCTCAGACTGAACTACTTCTTCTCGAGAAGAAGTAGTTCAGTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks