EMAIL THIS PAGE TO A FRIEND

SPHK1

sphingosine kinase 1

Synonyms: SPHK
UniProtKB ID: Q9NYA1, Q8N632, Q96GK1, Q9HD92, Q9NY70, Q9NYL3
Gene ID:
Human(8877) Summary: The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(20698) sphingosine kinase 1
Rat(170897) sphingosine kinase 1
Thale Cress(828239) sphingosine kinase 1
chicken(427803) sphingosine kinase 1
dog(483329) sphingosine kinase 1
domestic cat(101084918) sphingosine kinase 1
Horse(100058875) sphingosine kinase 1
cow(618605) sphingosine kinase 1
sheep(101105263) sphingosine kinase 1
domestic guinea pig(100727266) sphingosine kinase 1
naked mole-rat(101711606) sphingosine kinase 1
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182965 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021972 Rosetta Predictions human pricing
NM_182965 Rosetta Predictions human pricing
NM_133386 Rosetta Predictions rat pricing
NM_011451 Rosetta Predictions mouse pricing
NM_025367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169403 predicted 762
2 SASI_Hs01_00169404 predicted 946
3 SASI_Hs01_00169405 predicted 823
4 SASI_Hs01_00169406 predicted 1053
5 SASI_Hs01_00169407 predicted 1062
6 SASI_Hs01_00169408 predicted 788
7 SASI_Hs01_00169409 predicted 1267
8 SASI_Hs01_00169410 predicted 684
9 SASI_Hs01_00169411 predicted 822
10 SASI_Hs01_00169412 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207833 predicted 1056
2 SASI_Hs01_00207834 predicted 1238
3 SASI_Hs01_00207835 predicted 1116
4 SASI_Hs01_00207836 predicted 1340
5 SASI_Hs01_00207837 predicted 1353
6 SASI_Hs01_00207838 predicted 1082
7 SASI_Hs01_00207839 predicted 1553
8 SASI_Hs01_00207840 predicted 977
9 SASI_Hs01_00207841 predicted 1116
10 SASI_Hs01_00207842 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267646 predicted 1825
2 SASI_Rn01_00096583 predicted 2760
3 SASI_Rn01_00096584 predicted 2841
4 SASI_Rn01_00096585 predicted 2753
5 SASI_Rn01_00096586 predicted 2834
6 SASI_Rn01_00096587 predicted 2532
7 SASI_Rn01_00096588 predicted 2321
8 SASI_Rn01_00096589 predicted 2285
9 SASI_Rn01_00096590 predicted 2479
10 SASI_Rn01_00096591 predicted 1968
11 SASI_Rn01_00096592 predicted 2616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033983 predicted 766
2 SASI_Mm02_00320707 predicted 445
3 SASI_Mm01_00033986 predicted 1310
4 SASI_Mm01_00033985 predicted 1161
5 SASI_Mm02_00320708 predicted 1301
6 SASI_Mm01_00033984 predicted 331
7 SASI_Mm01_00033988 predicted 1038
8 SASI_Mm01_00033989 predicted 378
9 SASI_Mm01_00033990 predicted 1111
10 SASI_Mm01_00033991 predicted 751
11 SASI_Mm01_00033987 predicted 248
12 SASI_Mm01_00033992 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143082 predicted 881
2 SASI_Mm02_00328081 predicted 559
3 SASI_Mm01_00143083 predicted 1423
4 SASI_Mm01_00143084 predicted 1272
5 SASI_Mm01_00143086 predicted 1415
6 SASI_Mm01_00143087 predicted 447
7 SASI_Mm01_00143088 predicted 1159
8 SASI_Mm02_00328082 predicted 496
9 SASI_Mm01_00143089 predicted 1231
10 SASI_Mm01_00143090 predicted 865
11 SASI_Mm01_00143085 predicted 371
12 SASI_Mm01_00143091 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182965
VALIDATED
SPHK1 MISSION shRNA Bacterial Glycerol Stock
sphingosine kinase 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1640s1c1
Sequence:CCGGGCAGGCATATGGAGTATGAATCTCGAGATTCATACTCCATATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1063s1c1
Sequence:CCGGGCAGCTTCCTTGAACCATTATCTCGAGATAATGGTTCAAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1116s1c1
Sequence:CCGGCCTGACCAACTGCACGCTATTCTCGAGAATAGCGTGCAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182965.1-618s1c1
Sequence:CCGGCAGCACCGATAAGGAGCTGAACTCGAGTTCAGCTCCTTATCGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1779s1c1
Sequence:CCGGCCCAAACTACTTCTGGATGGTCTCGAGACCATCCAGAAGTAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1285s1c1
Sequence:CCGGCGCTTCACTCTGGGCACCTTCCTCGAGGAAGGTGCCCAGAGTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1603s1c1
Sequence:CCGGGCCATGCTGCTGCGCCTCTTCCTCGAGGAAGAGGCGCAGCAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1233s1c1
Sequence:CCGGCATTGCTGATGTGGACCTAGACTCGAGTCTAGGTCCACATCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182965.1-1987s1c1
Sequence:CCGGAGAAGGTGGAGGCTATGCTTTCTCGAGAAAGCATAGCCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182965.1-1881s1c1
Sequence:CCGGCGCTGTGCCTTAGTGTCTACTCTCGAGAGTAGACACTAAGGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1922s21c1
Sequence:CCGGCGCTGTGCCTTAGTGTCTACTCTCGAGAGTAGACACTAAGGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1820s21c1
Sequence:CCGGCCCAAACTACTTCTGGATGGTCTCGAGACCATCCAGAAGTAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1157s21c1
Sequence:CCGGCCTGACCAACTGCACGCTATTCTCGAGAATAGCGTGCAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1104s21c1
Sequence:CCGGGCAGCTTCCTTGAACCATTATCTCGAGATAATGGTTCAAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1288s21c1
Sequence:CCGGACCTAGAGAGTGAGAAGTATCCTCGAGGATACTTCTCACTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182965
VALIDATED
SPHK1 MISSION shRNA shRNA Plasmid DNA
sphingosine kinase 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1640s1c1
Sequence:CCGGGCAGGCATATGGAGTATGAATCTCGAGATTCATACTCCATATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1063s1c1
Sequence:CCGGGCAGCTTCCTTGAACCATTATCTCGAGATAATGGTTCAAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1116s1c1
Sequence:CCGGCCTGACCAACTGCACGCTATTCTCGAGAATAGCGTGCAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182965.1-618s1c1
Sequence:CCGGCAGCACCGATAAGGAGCTGAACTCGAGTTCAGCTCCTTATCGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1779s1c1
Sequence:CCGGCCCAAACTACTTCTGGATGGTCTCGAGACCATCCAGAAGTAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1285s1c1
Sequence:CCGGCGCTTCACTCTGGGCACCTTCCTCGAGGAAGGTGCCCAGAGTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1603s1c1
Sequence:CCGGGCCATGCTGCTGCGCCTCTTCCTCGAGGAAGAGGCGCAGCAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1233s1c1
Sequence:CCGGCATTGCTGATGTGGACCTAGACTCGAGTCTAGGTCCACATCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182965.1-1987s1c1
Sequence:CCGGAGAAGGTGGAGGCTATGCTTTCTCGAGAAAGCATAGCCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182965.1-1881s1c1
Sequence:CCGGCGCTGTGCCTTAGTGTCTACTCTCGAGAGTAGACACTAAGGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1922s21c1
Sequence:CCGGCGCTGTGCCTTAGTGTCTACTCTCGAGAGTAGACACTAAGGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1820s21c1
Sequence:CCGGCCCAAACTACTTCTGGATGGTCTCGAGACCATCCAGAAGTAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1157s21c1
Sequence:CCGGCCTGACCAACTGCACGCTATTCTCGAGAATAGCGTGCAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1104s21c1
Sequence:CCGGGCAGCTTCCTTGAACCATTATCTCGAGATAATGGTTCAAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1288s21c1
Sequence:CCGGACCTAGAGAGTGAGAAGTATCCTCGAGGATACTTCTCACTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182965
VALIDATED
SPHK1 MISSION shRNA Lentiviral Transduction Particles
sphingosine kinase 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1640s1c1
Sequence:CCGGGCAGGCATATGGAGTATGAATCTCGAGATTCATACTCCATATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1063s1c1
Sequence:CCGGGCAGCTTCCTTGAACCATTATCTCGAGATAATGGTTCAAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1116s1c1
Sequence:CCGGCCTGACCAACTGCACGCTATTCTCGAGAATAGCGTGCAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182965.1-618s1c1
Sequence:CCGGCAGCACCGATAAGGAGCTGAACTCGAGTTCAGCTCCTTATCGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182965.1-1779s1c1
Sequence:CCGGCCCAAACTACTTCTGGATGGTCTCGAGACCATCCAGAAGTAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1285s1c1
Sequence:CCGGCGCTTCACTCTGGGCACCTTCCTCGAGGAAGGTGCCCAGAGTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1603s1c1
Sequence:CCGGGCCATGCTGCTGCGCCTCTTCCTCGAGGAAGAGGCGCAGCAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182965.1-1233s1c1
Sequence:CCGGCATTGCTGATGTGGACCTAGACTCGAGTCTAGGTCCACATCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182965.1-1987s1c1
Sequence:CCGGAGAAGGTGGAGGCTATGCTTTCTCGAGAAAGCATAGCCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182965.1-1881s1c1
Sequence:CCGGCGCTGTGCCTTAGTGTCTACTCTCGAGAGTAGACACTAAGGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1922s21c1
Sequence:CCGGCGCTGTGCCTTAGTGTCTACTCTCGAGAGTAGACACTAAGGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1820s21c1
Sequence:CCGGCCCAAACTACTTCTGGATGGTCTCGAGACCATCCAGAAGTAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1157s21c1
Sequence:CCGGCCTGACCAACTGCACGCTATTCTCGAGAATAGCGTGCAGTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1104s21c1
Sequence:CCGGGCAGCTTCCTTGAACCATTATCTCGAGATAATGGTTCAAGGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_182965.2-1288s21c1
Sequence:CCGGACCTAGAGAGTGAGAAGTATCCTCGAGGATACTTCTCACTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011451
VALIDATED
SPHK1 MISSION shRNA Bacterial Glycerol Stock
sphingosine kinase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-1158s1c1
Sequence:CCGGGCACCCAAACTACCTTTGGATCTCGAGATCCAAAGGTAGTTTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-229s1c1
Sequence:CCGGGAGGCAGAGATAACCTTTAAACTCGAGTTTAAAGGTTATCTCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-480s1c1
Sequence:CCGGGCAGGTGACTAATGAAGACCTCTCGAGAGGTCTTCATTAGTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-683s1c1
Sequence:CCGGGCACCTTCTTTCGCCTAGCAACTCGAGTTGCTAGGCGAAAGAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011451.1-832s1c1
Sequence:CCGGCCTTCTCATTGGACTGTGGTACTCGAGTACCACAGTCCAATGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-1228s21c1
Sequence:CCGGCCACCTCCAGAAGAACCATAACTCGAGTTATGGTTCTTCTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-742s21c1
Sequence:CCGGGTAGGAACTGTGGCCTCTAAGCTCGAGCTTAGAGGCCACAGTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011451.2-1263s21c1
Sequence:CCGGCTACTCTGTCTAGGCTGAGATCTCGAGATCTCAGCCTAGACAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-683s21c1
Sequence:CCGGGCACCTTCTTTCGCCTAGCAACTCGAGTTGCTAGGCGAAAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011451.2-1306s21c1
Sequence:CCGGTCCTGGTATGGGAGGTTATTTCTCGAGAAATAACCTCCCATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-229s21c1
Sequence:CCGGGAGGCAGAGATAACCTTTAAACTCGAGTTTAAAGGTTATCTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-480s21c1
Sequence:CCGGGCAGGTGACTAATGAAGACCTCTCGAGAGGTCTTCATTAGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-1011s21c1
Sequence:CCGGCATGCAGAAGGGCAAGCATATCTCGAGATATGCTTGCCCTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011451
VALIDATED
SPHK1 MISSION shRNA shRNA Plasmid DNA
sphingosine kinase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-1158s1c1
Sequence:CCGGGCACCCAAACTACCTTTGGATCTCGAGATCCAAAGGTAGTTTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-229s1c1
Sequence:CCGGGAGGCAGAGATAACCTTTAAACTCGAGTTTAAAGGTTATCTCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-480s1c1
Sequence:CCGGGCAGGTGACTAATGAAGACCTCTCGAGAGGTCTTCATTAGTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-683s1c1
Sequence:CCGGGCACCTTCTTTCGCCTAGCAACTCGAGTTGCTAGGCGAAAGAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011451.1-832s1c1
Sequence:CCGGCCTTCTCATTGGACTGTGGTACTCGAGTACCACAGTCCAATGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-1228s21c1
Sequence:CCGGCCACCTCCAGAAGAACCATAACTCGAGTTATGGTTCTTCTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-742s21c1
Sequence:CCGGGTAGGAACTGTGGCCTCTAAGCTCGAGCTTAGAGGCCACAGTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011451.2-1263s21c1
Sequence:CCGGCTACTCTGTCTAGGCTGAGATCTCGAGATCTCAGCCTAGACAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-683s21c1
Sequence:CCGGGCACCTTCTTTCGCCTAGCAACTCGAGTTGCTAGGCGAAAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011451.2-1306s21c1
Sequence:CCGGTCCTGGTATGGGAGGTTATTTCTCGAGAAATAACCTCCCATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-229s21c1
Sequence:CCGGGAGGCAGAGATAACCTTTAAACTCGAGTTTAAAGGTTATCTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-480s21c1
Sequence:CCGGGCAGGTGACTAATGAAGACCTCTCGAGAGGTCTTCATTAGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-1011s21c1
Sequence:CCGGCATGCAGAAGGGCAAGCATATCTCGAGATATGCTTGCCCTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011451
VALIDATED
SPHK1 MISSION shRNA Lentiviral Transduction Particles
sphingosine kinase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-1158s1c1
Sequence:CCGGGCACCCAAACTACCTTTGGATCTCGAGATCCAAAGGTAGTTTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-229s1c1
Sequence:CCGGGAGGCAGAGATAACCTTTAAACTCGAGTTTAAAGGTTATCTCTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-480s1c1
Sequence:CCGGGCAGGTGACTAATGAAGACCTCTCGAGAGGTCTTCATTAGTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011451.1-683s1c1
Sequence:CCGGGCACCTTCTTTCGCCTAGCAACTCGAGTTGCTAGGCGAAAGAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011451.1-832s1c1
Sequence:CCGGCCTTCTCATTGGACTGTGGTACTCGAGTACCACAGTCCAATGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-1228s21c1
Sequence:CCGGCCACCTCCAGAAGAACCATAACTCGAGTTATGGTTCTTCTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-742s21c1
Sequence:CCGGGTAGGAACTGTGGCCTCTAAGCTCGAGCTTAGAGGCCACAGTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011451.2-1263s21c1
Sequence:CCGGCTACTCTGTCTAGGCTGAGATCTCGAGATCTCAGCCTAGACAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-683s21c1
Sequence:CCGGGCACCTTCTTTCGCCTAGCAACTCGAGTTGCTAGGCGAAAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011451.2-1306s21c1
Sequence:CCGGTCCTGGTATGGGAGGTTATTTCTCGAGAAATAACCTCCCATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-229s21c1
Sequence:CCGGGAGGCAGAGATAACCTTTAAACTCGAGTTTAAAGGTTATCTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-480s21c1
Sequence:CCGGGCAGGTGACTAATGAAGACCTCTCGAGAGGTCTTCATTAGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011451.2-1011s21c1
Sequence:CCGGCATGCAGAAGGGCAAGCATATCTCGAGATATGCTTGCCCTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks