EMAIL THIS PAGE TO A FRIEND

SPHK2

sphingosine kinase 2

Synonyms: SK 2 SK-2 SPK 2 SPK-2
UniProtKB ID: Q9NRA0, B4DU87, Q9BRN1, Q9H0Q2, Q9NWU7
Gene ID:
Human(56848) Summary: This gene encodes one of two sphingosine kinase isozymes that catalyze the phosphorylation of sphingosine into sphingosine 1-phosphate. Sphingosine 1-phosphate mediates many cellular processes including migration, proliferation and apoptosis, and also plays a role in several types of cancer by promoting angiogenesis and tumorigenesis. The encoded protein may play a role in breast cancer proliferation and chemoresistance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Mouse(56632) sphingosine kinase 2
Rat(308589) sphingosine kinase 2
naked mole-rat(101720879) sphingosine kinase 2
domestic guinea pig(100730608) sphingosine kinase 2
cow(533103) sphingosine kinase 2
sheep(101106964) sphingosine kinase 2
Zebrafish(100150090) sphingosine kinase 2
domestic cat(101081345) sphingosine kinase 2
Horse(100054066) sphingosine kinase 2
dog(484401) sphingosine kinase 2
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020126 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020126 Rosetta Predictions human pricing
NM_001012066 Rosetta Predictions rat pricing
XM_574450 Rosetta Predictions rat pricing
NM_020011 Rosetta Predictions mouse pricing
NM_203280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158544 predicted 2530
2 SASI_Hs01_00158545 predicted 2526
3 SASI_Hs01_00158546 predicted 2663
4 SASI_Hs01_00158547 predicted 1059
5 SASI_Hs01_00158549 predicted 1303
6 SASI_Hs02_00352990 predicted 2499
7 SASI_Hs01_00158550 predicted 2443
8 SASI_Hs01_00158551 predicted 967
9 SASI_Hs01_00158552 predicted 2465
10 SASI_Hs01_00158553 predicted 2267
11 SASI_Hs01_00158548 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100152 predicted 2152
2 SASI_Rn01_00100153 predicted 815
3 SASI_Rn01_00100154 predicted 853
4 SASI_Rn01_00100155 predicted 766
5 SASI_Rn01_00100156 predicted 1956
6 SASI_Rn01_00100157 predicted 2097
7 SASI_Rn01_00100158 predicted 1698
8 SASI_Rn01_00100159 predicted 2102
9 SASI_Rn01_00100160 predicted 1945
10 SASI_Rn01_00100161 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195303 predicted 1775
2 SASI_Rn01_00195304 predicted 2697
3 SASI_Rn01_00195305 predicted 1362
4 SASI_Rn01_00195306 predicted 1773
5 SASI_Rn01_00195307 predicted 2046
6 SASI_Rn01_00195308 predicted 1404
7 SASI_Rn01_00195309 predicted 1717
8 SASI_Rn01_00195310 predicted 1320
9 SASI_Rn01_00195311 predicted 2513
10 SASI_Rn01_00195312 predicted 2645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050883 predicted 2287
2 SASI_Mm02_00325380 predicted 2569
3 SASI_Mm02_00325381 predicted 2575
4 SASI_Mm02_00325382 predicted 2518
5 SASI_Mm01_00050884 predicted 903
6 SASI_Mm02_00325383 predicted 1736
7 SASI_Mm02_00325384 predicted 2437
8 SASI_Mm01_00050885 predicted 1110
9 SASI_Mm01_00050887 predicted 2244
10 SASI_Mm01_00050890 predicted 1296
11 SASI_Mm01_00050881 predicted 1271
12 SASI_Mm01_00050882 predicted 1512
13 SASI_Mm01_00050886 predicted 1229
14 SASI_Mm01_00050888 predicted 836
15 SASI_Mm01_00050889 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082075 predicted 947
2 SASI_Mm01_00082076 predicted 1184
3 SASI_Mm01_00082077 predicted 1956
4 SASI_Mm02_00351756 predicted 2241
5 SASI_Mm02_00351757 predicted 2245
6 SASI_Mm02_00351758 predicted 2192
7 SASI_Mm01_00082078 predicted 579
8 SASI_Mm02_00351759 predicted 2106
9 SASI_Mm01_00082079 predicted 784
10 SASI_Mm01_00082081 predicted 1916
11 SASI_Mm01_00082080 predicted 897
12 SASI_Mm01_00082082 predicted 512
13 SASI_Mm01_00082083 predicted 1265
14 SASI_Mm01_00082084 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020011
VALIDATED
SPHK2 MISSION shRNA Bacterial Glycerol Stock
sphingosine kinase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020011.4-2734s21c1
Sequence:CCGGGCAAGGCTTCTTCAGCTTATTCTCGAGAATAAGCTGAAGAAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020011.4-2570s21c1
Sequence:CCGGATAGGCTAAGATCTATCATTTCTCGAGAAATGATAGATCTTAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2295s21c1
Sequence:CCGGCGGGCTGCACTTCTACGCATTCTCGAGAATGCGTAGAAGTGCAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2149s21c1
Sequence:CCGGCCCAAGACTGGGTGACAATAGCTCGAGCTATTGTCACCCAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2519s21c1
Sequence:CCGGACAAGCCTGAACGAGCCTAAACTCGAGTTTAGGCTCGTTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-778s21c3
Sequence:CCGGCAACACAAGCCCTACACATACCTCGAGGTATGTGTAGGGCTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-1114s21c1
Sequence:CCGGGGCTGCTCATATTGGTCAATCCTCGAGGATTGACCAATATGAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020011.3-987s1c1
Sequence:CCGGGCCACCACTTATGAGGAGAATCTCGAGATTCTCCTCATAAGTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-1118s1c1
Sequence:CCGGGCTCATATTGGTCAATCCCTTCTCGAGAAGGGATTGACCAATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-2295s1c1
Sequence:CCGGCGGGCTGCACTTCTACGCATTCTCGAGAATGCGTAGAAGTGCAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-2438s1c1
Sequence:CCGGGTTAGTGGAGTATGGGCCAATCTCGAGATTGGCCCATACTCCACTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020011
VALIDATED
SPHK2 MISSION shRNA shRNA Plasmid DNA
sphingosine kinase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020011.4-2734s21c1
Sequence:CCGGGCAAGGCTTCTTCAGCTTATTCTCGAGAATAAGCTGAAGAAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020011.4-2570s21c1
Sequence:CCGGATAGGCTAAGATCTATCATTTCTCGAGAAATGATAGATCTTAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2295s21c1
Sequence:CCGGCGGGCTGCACTTCTACGCATTCTCGAGAATGCGTAGAAGTGCAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2149s21c1
Sequence:CCGGCCCAAGACTGGGTGACAATAGCTCGAGCTATTGTCACCCAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2519s21c1
Sequence:CCGGACAAGCCTGAACGAGCCTAAACTCGAGTTTAGGCTCGTTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-778s21c3
Sequence:CCGGCAACACAAGCCCTACACATACCTCGAGGTATGTGTAGGGCTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-1114s21c1
Sequence:CCGGGGCTGCTCATATTGGTCAATCCTCGAGGATTGACCAATATGAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020011.3-987s1c1
Sequence:CCGGGCCACCACTTATGAGGAGAATCTCGAGATTCTCCTCATAAGTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-1118s1c1
Sequence:CCGGGCTCATATTGGTCAATCCCTTCTCGAGAAGGGATTGACCAATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-2295s1c1
Sequence:CCGGCGGGCTGCACTTCTACGCATTCTCGAGAATGCGTAGAAGTGCAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-2438s1c1
Sequence:CCGGGTTAGTGGAGTATGGGCCAATCTCGAGATTGGCCCATACTCCACTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020011
VALIDATED
SPHK2 MISSION shRNA Lentiviral Transduction Particles
sphingosine kinase 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020011.4-2734s21c1
Sequence:CCGGGCAAGGCTTCTTCAGCTTATTCTCGAGAATAAGCTGAAGAAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020011.4-2570s21c1
Sequence:CCGGATAGGCTAAGATCTATCATTTCTCGAGAAATGATAGATCTTAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2295s21c1
Sequence:CCGGCGGGCTGCACTTCTACGCATTCTCGAGAATGCGTAGAAGTGCAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2149s21c1
Sequence:CCGGCCCAAGACTGGGTGACAATAGCTCGAGCTATTGTCACCCAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-2519s21c1
Sequence:CCGGACAAGCCTGAACGAGCCTAAACTCGAGTTTAGGCTCGTTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-778s21c3
Sequence:CCGGCAACACAAGCCCTACACATACCTCGAGGTATGTGTAGGGCTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020011.4-1114s21c1
Sequence:CCGGGGCTGCTCATATTGGTCAATCCTCGAGGATTGACCAATATGAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020011.3-987s1c1
Sequence:CCGGGCCACCACTTATGAGGAGAATCTCGAGATTCTCCTCATAAGTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-1118s1c1
Sequence:CCGGGCTCATATTGGTCAATCCCTTCTCGAGAAGGGATTGACCAATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-2295s1c1
Sequence:CCGGCGGGCTGCACTTCTACGCATTCTCGAGAATGCGTAGAAGTGCAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020011.3-2438s1c1
Sequence:CCGGGTTAGTGGAGTATGGGCCAATCTCGAGATTGGCCCATACTCCACTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020126
VALIDATED
SPHK2 MISSION shRNA Bacterial Glycerol Stock
sphingosine kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020126.3-911s21c1
Sequence:CCGGGGTTGCTTCTATTGGTCAATCCTCGAGGATTGACCAATAGAAGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020126.3-1380s21c1
Sequence:CCGGCTTCGTGTCAGATGTGGATATCTCGAGATATCCACATCTGACACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020126.3-2450s21c1
Sequence:CCGGCAGGATTGCGCTCGCTTTCATCTCGAGATGAAAGCGAGCGCAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020126.3-2533s21c1
Sequence:CCGGGAGGGTAGTGCCTGATCAATGCTCGAGCATTGATCAGGCACTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020126.3-1799s1c1
Sequence:CCGGCCAAGGCAGCTCTACACTCACCTCGAGGTGAGTGTAGAGCTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020126.3-1017s1c1
Sequence:CCGGCATCCAGACAGAACGACAGAACTCGAGTTCTGTCGTTCTGTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-1379s1c1
Sequence:CCGGGCTTCGTGTCAGATGTGGATACTCGAGTATCCACATCTGACACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020126.3-705s1c1
Sequence:CCGGCTACTTCTGCATCTACACCTACTCGAGTAGGTGTAGATGCAGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-1977s1c1
Sequence:CCGGCTTTGTGCTCATGTTGGCCATCTCGAGATGGCCAACATGAGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020126.3-1266s1c1
Sequence:CCGGGTTGCTCAACTGCTCACTGTTCTCGAGAACAGTGAGCAGTTGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-916s1c1
Sequence:CCGGCTTCTATTGGTCAATCCCTTTCTCGAGAAAGGGATTGACCAATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020126
VALIDATED
SPHK2 MISSION shRNA shRNA Plasmid DNA
sphingosine kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020126.3-911s21c1
Sequence:CCGGGGTTGCTTCTATTGGTCAATCCTCGAGGATTGACCAATAGAAGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020126.3-1380s21c1
Sequence:CCGGCTTCGTGTCAGATGTGGATATCTCGAGATATCCACATCTGACACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020126.3-2450s21c1
Sequence:CCGGCAGGATTGCGCTCGCTTTCATCTCGAGATGAAAGCGAGCGCAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020126.3-2533s21c1
Sequence:CCGGGAGGGTAGTGCCTGATCAATGCTCGAGCATTGATCAGGCACTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020126.3-1799s1c1
Sequence:CCGGCCAAGGCAGCTCTACACTCACCTCGAGGTGAGTGTAGAGCTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020126.3-1017s1c1
Sequence:CCGGCATCCAGACAGAACGACAGAACTCGAGTTCTGTCGTTCTGTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-1379s1c1
Sequence:CCGGGCTTCGTGTCAGATGTGGATACTCGAGTATCCACATCTGACACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020126.3-705s1c1
Sequence:CCGGCTACTTCTGCATCTACACCTACTCGAGTAGGTGTAGATGCAGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-1977s1c1
Sequence:CCGGCTTTGTGCTCATGTTGGCCATCTCGAGATGGCCAACATGAGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020126.3-1266s1c1
Sequence:CCGGGTTGCTCAACTGCTCACTGTTCTCGAGAACAGTGAGCAGTTGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-916s1c1
Sequence:CCGGCTTCTATTGGTCAATCCCTTTCTCGAGAAAGGGATTGACCAATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020126
VALIDATED
SPHK2 MISSION shRNA Lentiviral Transduction Particles
sphingosine kinase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020126.3-911s21c1
Sequence:CCGGGGTTGCTTCTATTGGTCAATCCTCGAGGATTGACCAATAGAAGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020126.3-1380s21c1
Sequence:CCGGCTTCGTGTCAGATGTGGATATCTCGAGATATCCACATCTGACACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020126.3-2450s21c1
Sequence:CCGGCAGGATTGCGCTCGCTTTCATCTCGAGATGAAAGCGAGCGCAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020126.3-2533s21c1
Sequence:CCGGGAGGGTAGTGCCTGATCAATGCTCGAGCATTGATCAGGCACTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020126.3-1799s1c1
Sequence:CCGGCCAAGGCAGCTCTACACTCACCTCGAGGTGAGTGTAGAGCTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020126.3-1017s1c1
Sequence:CCGGCATCCAGACAGAACGACAGAACTCGAGTTCTGTCGTTCTGTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-1379s1c1
Sequence:CCGGGCTTCGTGTCAGATGTGGATACTCGAGTATCCACATCTGACACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020126.3-705s1c1
Sequence:CCGGCTACTTCTGCATCTACACCTACTCGAGTAGGTGTAGATGCAGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-1977s1c1
Sequence:CCGGCTTTGTGCTCATGTTGGCCATCTCGAGATGGCCAACATGAGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020126.3-1266s1c1
Sequence:CCGGGTTGCTCAACTGCTCACTGTTCTCGAGAACAGTGAGCAGTTGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020126.3-916s1c1
Sequence:CCGGCTTCTATTGGTCAATCCCTTTCTCGAGAAAGGGATTGACCAATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks