EMAIL THIS PAGE TO A FRIEND

SPHKAP

SPHK1 interactor, AKAP domain containing

Synonyms: SKIP
UniProtKB ID: Q2M3C7, Q68DA3, Q68DR8, Q9C0I5
Gene ID:
Mouse(77629) SPHK1 interactor, AKAP domain containing
Rat(316561) SPHK1 interactor, AKAP domain containing
Zebrafish(100034387) SPHK1 interactor, AKAP domain containing
chicken(424789) SPHK1 interactor, AKAP domain containing
Horse(100062788) SPHK1 interactor, AKAP domain containing
domestic cat(101092205) SPHK1 interactor, AKAP domain containing
dog(609866) SPHK1 interactor, AKAP domain containing
cow(540759) SPHK1 interactor, AKAP domain containing
sheep(101118932) SPHK1 interactor, AKAP domain containing
domestic guinea pig(100730756) SPHK1 interactor, AKAP domain containing
naked mole-rat(101717292) SPHK1 interactor, AKAP domain containing
Domestic Rabbit(100338233) SPHK1 interactor, AKAP domain containing
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_051221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_051221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_051221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030623 Rosetta Predictions human pricing
NM_001127492 Rosetta Predictions rat pricing
NM_172430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059486 predicted 3319
2 SASI_Hs01_00059487 predicted 702
3 SASI_Hs01_00059489 predicted 412
4 SASI_Hs02_00358179 predicted 2264
5 SASI_Hs01_00059490 predicted 972
6 SASI_Hs02_00358180 predicted 1507
7 SASI_Hs01_00059491 predicted 480
8 SASI_Hs01_00059492 predicted 3462
9 SASI_Hs01_00059493 predicted 3892
10 SASI_Hs01_00059494 predicted 2455
11 SASI_Hs01_00059488 predicted 1660
12 SASI_Hs01_00059495 predicted 4111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253893 predicted 1986
2 SASI_Rn02_00253894 predicted 1376
3 SASI_Rn02_00253895 predicted 339
4 SASI_Rn02_00253896 predicted 3734
5 SASI_Rn02_00253897 predicted 1942
6 SASI_Rn02_00253898 predicted 604
7 SASI_Rn02_00253899 predicted 2823
8 SASI_Rn02_00253900 predicted 4990
9 SASI_Rn02_00253901 predicted 3860
10 SASI_Rn02_00253902 predicted 4381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158499 predicted 5236
2 SASI_Mm01_00158500 predicted 4219
3 SASI_Mm01_00158501 predicted 1236
4 SASI_Mm02_00343918 predicted 2901
5 SASI_Mm01_00158503 predicted 4271
6 SASI_Mm01_00158505 predicted 1741
7 SASI_Mm01_00158506 predicted 1205
8 SASI_Mm02_00343919 predicted 1910
9 SASI_Mm01_00158507 predicted 821
10 SASI_Mm02_00343920 predicted 218
11 SASI_Mm01_00158502 predicted 2797
12 SASI_Mm01_00158504 predicted 536
13 SASI_Mm01_00158508 predicted 3682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_051221
SPHKAP MISSION shRNA Bacterial Glycerol Stock
SPHK1 interactor, AKAP domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-5070s1c1
Sequence:CCGGCCCACCATCTACTTTAAGAAACTCGAGTTTCTTAAAGTAGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-3539s1c1
Sequence:CCGGGCTGGATTACTATGCTGGCAACTCGAGTTGCCAGCATAGTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-2113s1c1
Sequence:CCGGCCAATGTTATCCTGAGGCATTCTCGAGAATGCCTCAGGATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-2919s1c1
Sequence:CCGGGCAACTGAAATTGCAGCGATTCTCGAGAATCGCTGCAATTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-1608s1c1
Sequence:CCGGGCCACTGTGATTGGAACTATTCTCGAGAATAGTTCCAATCACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_051221
SPHKAP MISSION shRNA shRNA Plasmid DNA
SPHK1 interactor, AKAP domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-5070s1c1
Sequence:CCGGCCCACCATCTACTTTAAGAAACTCGAGTTTCTTAAAGTAGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-3539s1c1
Sequence:CCGGGCTGGATTACTATGCTGGCAACTCGAGTTGCCAGCATAGTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-2113s1c1
Sequence:CCGGCCAATGTTATCCTGAGGCATTCTCGAGAATGCCTCAGGATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-2919s1c1
Sequence:CCGGGCAACTGAAATTGCAGCGATTCTCGAGAATCGCTGCAATTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-1608s1c1
Sequence:CCGGGCCACTGTGATTGGAACTATTCTCGAGAATAGTTCCAATCACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_051221
SPHKAP MISSION shRNA Lentiviral Transduction Particles
SPHK1 interactor, AKAP domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-5070s1c1
Sequence:CCGGCCCACCATCTACTTTAAGAAACTCGAGTTTCTTAAAGTAGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-3539s1c1
Sequence:CCGGGCTGGATTACTATGCTGGCAACTCGAGTTGCCAGCATAGTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-2113s1c1
Sequence:CCGGCCAATGTTATCCTGAGGCATTCTCGAGAATGCCTCAGGATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-2919s1c1
Sequence:CCGGGCAACTGAAATTGCAGCGATTCTCGAGAATCGCTGCAATTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051221.5-1608s1c1
Sequence:CCGGGCCACTGTGATTGGAACTATTCTCGAGAATAGTTCCAATCACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172430
SPHKAP MISSION shRNA Bacterial Glycerol Stock
SPHK1 interactor, AKAP domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172430.2-5789s1c1
Sequence:CCGGGCTACATTTATTGCTTGGATACTCGAGTATCCAAGCAATAAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-4239s1c1
Sequence:CCGGGCTGTTACTGAAGGCAATCATCTCGAGATGATTGCCTTCAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-2799s1c1
Sequence:CCGGGCTCAAGCTAACCTATCCTTACTCGAGTAAGGATAGGTTAGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-3107s1c1
Sequence:CCGGCCTCAGTGAAATCAAGAGAAACTCGAGTTTCTCTTGATTTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-1654s1c1
Sequence:CCGGCCACTGTGATTGGAACCATTTCTCGAGAAATGGTTCCAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172430.3-5261s21c1
Sequence:CCGGCCCATTAGCAGAACTACTTAACTCGAGTTAAGTAGTTCTGCTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172430.3-1820s21c1
Sequence:CCGGCACCTTCTACAACCGAGTATTCTCGAGAATACTCGGTTGTAGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172430.3-5469s21c1
Sequence:CCGGCAATAGAGAGTGAGCTATATCCTCGAGGATATAGCTCACTCTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172430
SPHKAP MISSION shRNA shRNA Plasmid DNA
SPHK1 interactor, AKAP domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172430.2-5789s1c1
Sequence:CCGGGCTACATTTATTGCTTGGATACTCGAGTATCCAAGCAATAAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-4239s1c1
Sequence:CCGGGCTGTTACTGAAGGCAATCATCTCGAGATGATTGCCTTCAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-2799s1c1
Sequence:CCGGGCTCAAGCTAACCTATCCTTACTCGAGTAAGGATAGGTTAGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-3107s1c1
Sequence:CCGGCCTCAGTGAAATCAAGAGAAACTCGAGTTTCTCTTGATTTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-1654s1c1
Sequence:CCGGCCACTGTGATTGGAACCATTTCTCGAGAAATGGTTCCAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172430.3-5261s21c1
Sequence:CCGGCCCATTAGCAGAACTACTTAACTCGAGTTAAGTAGTTCTGCTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172430.3-1820s21c1
Sequence:CCGGCACCTTCTACAACCGAGTATTCTCGAGAATACTCGGTTGTAGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172430.3-5469s21c1
Sequence:CCGGCAATAGAGAGTGAGCTATATCCTCGAGGATATAGCTCACTCTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172430
SPHKAP MISSION shRNA Lentiviral Transduction Particles
SPHK1 interactor, AKAP domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172430.2-5789s1c1
Sequence:CCGGGCTACATTTATTGCTTGGATACTCGAGTATCCAAGCAATAAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-4239s1c1
Sequence:CCGGGCTGTTACTGAAGGCAATCATCTCGAGATGATTGCCTTCAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-2799s1c1
Sequence:CCGGGCTCAAGCTAACCTATCCTTACTCGAGTAAGGATAGGTTAGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-3107s1c1
Sequence:CCGGCCTCAGTGAAATCAAGAGAAACTCGAGTTTCTCTTGATTTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172430.2-1654s1c1
Sequence:CCGGCCACTGTGATTGGAACCATTTCTCGAGAAATGGTTCCAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172430.3-5261s21c1
Sequence:CCGGCCCATTAGCAGAACTACTTAACTCGAGTTAAGTAGTTCTGCTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172430.3-1820s21c1
Sequence:CCGGCACCTTCTACAACCGAGTATTCTCGAGAATACTCGGTTGTAGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172430.3-5469s21c1
Sequence:CCGGCAATAGAGAGTGAGCTATATCCTCGAGGATATAGCTCACTCTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks