EMAIL THIS PAGE TO A FRIEND

SPI1

spleen focus forming virus (SFFV) proviral integration oncogene

Synonyms: OF PU.1 SFPI1 SPI-1 SPI-A
UniProtKB ID: P17947
Gene ID:
Human(6688) Summary: This gene encodes an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to a purine-rich sequence known as the PU-box found near the promoters of target genes, and regulates their expression in coordination with other transcription factors and cofactors. The protein can also regulate alternative splicing of target genes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20375) spleen focus forming virus (SFFV) proviral integration oncogene
Rat(366126) spleen focus forming virus (SFFV) proviral integration oncogene
chicken(395879) spleen focus forming virus (SFFV) proviral integration oncogene spi1
domestic cat(101094951) spleen focus forming virus (SFFV) proviral integration oncogene spi1
dog(611255) spleen focus forming virus (SFFV) proviral integration oncogene spi1
cow(507100) spleen focus forming virus (SFFV) proviral integration oncogene spi1
sheep(101119756) spleen focus forming virus (SFFV) proviral integration oncogene spi1
naked mole-rat(101707724) spleen focus forming virus (SFFV) proviral integration oncogene spi1
domestic guinea pig(100727094) spleen focus forming virus (SFFV) proviral integration oncogene spi1
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500842 Anti-PU.1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB5500170 Anti-PU.1 antibody, Rabbit monoclonal clone SP238, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
AV37890 Anti-SFPI1 antibody produced in rabbit IgG fraction of antiserum bovine, canine, pig, guinea pig, zebrafish, human, mouse, horse, rat, rabbit
western blot pricing
AV31421 Anti-SPI1 antibody produced in rabbit affinity isolated antibody horse, human, pig, mouse, bovine, guinea pig, canine, rat
western blot pricing
SAB2102283 Anti-SPI1 antibody produced in rabbit affinity isolated antibody , guinea pig, canine, human, bovine, zebrafish, rat, pig, mouse, horse
western blot pricing
HPA044653 Anti-SPI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4502840 Anti-SPI1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
pricing
WH0006688M1 Monoclonal Anti-SPI1 antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404402 Monoclonal Anti-SPI1, (N-terminal) antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003120 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058901 MISSION® esiRNA esiRNA targeting mouse Sfpi1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080547 Rosetta Predictions human pricing
NM_003120 Rosetta Predictions human pricing
NM_001005892 Rosetta Predictions rat pricing
NM_011355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315880 predicted 770
2 SASI_Hs02_00315881 predicted 657
3 SASI_Hs02_00315882 predicted 715
4 SASI_Hs02_00315883 predicted 784
5 SASI_Hs02_00315884 predicted 494
6 SASI_Hs02_00315885 predicted 782
7 SASI_Hs02_00315886 predicted 480
8 SASI_Hs02_00315887 predicted 792
9 SASI_Hs02_00315888 predicted 539
10 SASI_Hs02_00315889 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335096 predicted 922
2 SASI_Hs02_00335097 predicted 877
3 SASI_Hs02_00335098 predicted 710
4 SASI_Hs02_00335099 predicted 777
5 SASI_Hs02_00335100 predicted 923
6 SASI_Hs02_00335101 predicted 885
7 SASI_Hs01_00200898 predicted 487
8 SASI_Hs02_00335102 predicted 785
9 SASI_Hs02_00335103 predicted 471
10 SASI_Hs02_00335104 predicted 537
11 SASI_Hs01_00200897 predicted 267
12 SASI_Hs01_00200899 predicted 285
13 SASI_Hs01_00200900 predicted 242
14 SASI_Hs01_00200901 predicted 386
15 SASI_Hs01_00200902 predicted 254
16 SASI_Hs01_00200903 predicted 286
17 SASI_Hs01_00200904 predicted 251
18 SASI_Hs01_00200905 predicted 270
19 SASI_Hs01_00200906 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101692 predicted 816
2 SASI_Rn01_00101693 predicted 861
3 SASI_Rn01_00101694 predicted 712
4 SASI_Rn01_00101697 predicted 206
5 SASI_Rn01_00101698 predicted 249
6 SASI_Rn01_00101699 predicted 350
7 SASI_Rn01_00101701 predicted 294
8 SASI_Rn02_00198479 predicted 424
9 SASI_Rn02_00198480 predicted 274
10 SASI_Rn02_00198481 predicted 300
11 SASI_Rn01_00101695 predicted 654
12 SASI_Rn01_00101696 predicted 290
13 SASI_Rn01_00101700 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148815 predicted 718
2 SASI_Mm02_00320509 predicted 856
3 SASI_Mm01_00148816 predicted 493
4 SASI_Mm02_00320510 predicted 313
5 SASI_Mm01_00148817 predicted 810
6 SASI_Mm01_00148820 predicted 426
7 SASI_Mm01_00148821 predicted 269
8 SASI_Mm01_00148822 predicted 239
9 SASI_Mm01_00148823 predicted 197
10 SASI_Mm01_00148824 predicted 211
11 SASI_Mm01_00148818 predicted 349
12 SASI_Mm01_00148819 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003120
SPI1 MISSION shRNA Bacterial Glycerol Stock
spleen focus forming virus (SFFV) proviral integration oncogene
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003120.2-411s21c1
Sequence:CCGGAGAGCTTCGCCGAGAACAACTCTCGAGAGTTGTTCTCGGCGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003120.2-1321s21c1
Sequence:CCGGCCGTATGTAAATCAGATCTCCCTCGAGGGAGATCTGATTTACATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003120.2-496s21c1
Sequence:CCGGGCAGATGCACGTCCTCGATACCTCGAGGTATCGAGGACGTGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-267s1c1
Sequence:CCGGCGGATCTATACCAACGCCAAACTCGAGTTTGGCGTTGGTATAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003120.1-1161s1c1
Sequence:CCGGCCTCCACATCCCGCTTCGCCTCTCGAGAGGCGAAGCGGGATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-928s1c1
Sequence:CCGGGAAGAAGCTCACCTACCAGTTCTCGAGAACTGGTAGGTGAGCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-691s1c1
Sequence:CCGGCAAGAAGAAGATCCGCCTGTACTCGAGTACAGGCGGATCTTCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-256s1c1
Sequence:CCGGGCCCTATGACACGGATCTATACTCGAGTATAGATCCGTGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003120
SPI1 MISSION shRNA shRNA Plasmid DNA
spleen focus forming virus (SFFV) proviral integration oncogene
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003120.2-411s21c1
Sequence:CCGGAGAGCTTCGCCGAGAACAACTCTCGAGAGTTGTTCTCGGCGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003120.2-1321s21c1
Sequence:CCGGCCGTATGTAAATCAGATCTCCCTCGAGGGAGATCTGATTTACATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003120.2-496s21c1
Sequence:CCGGGCAGATGCACGTCCTCGATACCTCGAGGTATCGAGGACGTGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-267s1c1
Sequence:CCGGCGGATCTATACCAACGCCAAACTCGAGTTTGGCGTTGGTATAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003120.1-1161s1c1
Sequence:CCGGCCTCCACATCCCGCTTCGCCTCTCGAGAGGCGAAGCGGGATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-928s1c1
Sequence:CCGGGAAGAAGCTCACCTACCAGTTCTCGAGAACTGGTAGGTGAGCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-691s1c1
Sequence:CCGGCAAGAAGAAGATCCGCCTGTACTCGAGTACAGGCGGATCTTCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-256s1c1
Sequence:CCGGGCCCTATGACACGGATCTATACTCGAGTATAGATCCGTGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003120
SPI1 MISSION shRNA Lentiviral Transduction Particles
spleen focus forming virus (SFFV) proviral integration oncogene
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003120.2-411s21c1
Sequence:CCGGAGAGCTTCGCCGAGAACAACTCTCGAGAGTTGTTCTCGGCGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003120.2-1321s21c1
Sequence:CCGGCCGTATGTAAATCAGATCTCCCTCGAGGGAGATCTGATTTACATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003120.2-496s21c1
Sequence:CCGGGCAGATGCACGTCCTCGATACCTCGAGGTATCGAGGACGTGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-267s1c1
Sequence:CCGGCGGATCTATACCAACGCCAAACTCGAGTTTGGCGTTGGTATAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003120.1-1161s1c1
Sequence:CCGGCCTCCACATCCCGCTTCGCCTCTCGAGAGGCGAAGCGGGATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-928s1c1
Sequence:CCGGGAAGAAGCTCACCTACCAGTTCTCGAGAACTGGTAGGTGAGCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-691s1c1
Sequence:CCGGCAAGAAGAAGATCCGCCTGTACTCGAGTACAGGCGGATCTTCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003120.1-256s1c1
Sequence:CCGGGCCCTATGACACGGATCTATACTCGAGTATAGATCCGTGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011355
SPI1 MISSION shRNA Bacterial Glycerol Stock
spleen focus forming virus (SFFV) proviral integration oncogene
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-228s21c1
Sequence:CCGGGAGCTATACCAACGTCCAATGCTCGAGCATTGGACGTTGGTATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-428s21c1
Sequence:CCGGACAGATGCACGTCCTCGATACCTCGAGGTATCGAGGACGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-503s21c1
Sequence:CCGGGATGTGCTTCCCTTATCAAACCTCGAGGTTTGATAAGGGAAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-290s21c1
Sequence:CCGGTAGCGATCACTACTGGGATTTCTCGAGAAATCCCAGTAGTGATCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-201s21c1
Sequence:CCGGTCGGATGACTTGGTTACTTACCTCGAGGTAAGTAACCAAGTCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011355.1-1033s1c1
Sequence:CCGGGCCCGGACACAGGGAGGACATCTCGAGATGTCCTCCCTGTGTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-320s1c1
Sequence:CCGGCCATGTCCACAACAACGAGTTCTCGAGAACTCGTTGTTGTGGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-501s1c1
Sequence:CCGGCGGATGTGCTTCCCTTATCAACTCGAGTTGATAAGGGAAGCACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-390s1c1
Sequence:CCGGCCGCAGCTACAGCAGCTCTATCTCGAGATAGAGCTGCTGTAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-818s1c1
Sequence:CCGGCAAGAAGATGACCTACCAGAACTCGAGTTCTGGTAGGTCATCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011355
SPI1 MISSION shRNA shRNA Plasmid DNA
spleen focus forming virus (SFFV) proviral integration oncogene
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-228s21c1
Sequence:CCGGGAGCTATACCAACGTCCAATGCTCGAGCATTGGACGTTGGTATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-428s21c1
Sequence:CCGGACAGATGCACGTCCTCGATACCTCGAGGTATCGAGGACGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-503s21c1
Sequence:CCGGGATGTGCTTCCCTTATCAAACCTCGAGGTTTGATAAGGGAAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-290s21c1
Sequence:CCGGTAGCGATCACTACTGGGATTTCTCGAGAAATCCCAGTAGTGATCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-201s21c1
Sequence:CCGGTCGGATGACTTGGTTACTTACCTCGAGGTAAGTAACCAAGTCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011355.1-1033s1c1
Sequence:CCGGGCCCGGACACAGGGAGGACATCTCGAGATGTCCTCCCTGTGTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-320s1c1
Sequence:CCGGCCATGTCCACAACAACGAGTTCTCGAGAACTCGTTGTTGTGGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-501s1c1
Sequence:CCGGCGGATGTGCTTCCCTTATCAACTCGAGTTGATAAGGGAAGCACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-390s1c1
Sequence:CCGGCCGCAGCTACAGCAGCTCTATCTCGAGATAGAGCTGCTGTAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-818s1c1
Sequence:CCGGCAAGAAGATGACCTACCAGAACTCGAGTTCTGGTAGGTCATCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011355
SPI1 MISSION shRNA Lentiviral Transduction Particles
spleen focus forming virus (SFFV) proviral integration oncogene
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-228s21c1
Sequence:CCGGGAGCTATACCAACGTCCAATGCTCGAGCATTGGACGTTGGTATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-428s21c1
Sequence:CCGGACAGATGCACGTCCTCGATACCTCGAGGTATCGAGGACGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-503s21c1
Sequence:CCGGGATGTGCTTCCCTTATCAAACCTCGAGGTTTGATAAGGGAAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-290s21c1
Sequence:CCGGTAGCGATCACTACTGGGATTTCTCGAGAAATCCCAGTAGTGATCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011355.1-201s21c1
Sequence:CCGGTCGGATGACTTGGTTACTTACCTCGAGGTAAGTAACCAAGTCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011355.1-1033s1c1
Sequence:CCGGGCCCGGACACAGGGAGGACATCTCGAGATGTCCTCCCTGTGTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-320s1c1
Sequence:CCGGCCATGTCCACAACAACGAGTTCTCGAGAACTCGTTGTTGTGGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-501s1c1
Sequence:CCGGCGGATGTGCTTCCCTTATCAACTCGAGTTGATAAGGGAAGCACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-390s1c1
Sequence:CCGGCCGCAGCTACAGCAGCTCTATCTCGAGATAGAGCTGCTGTAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011355.1-818s1c1
Sequence:CCGGCAAGAAGATGACCTACCAGAACTCGAGTTCTGGTAGGTCATCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks