EMAIL THIS PAGE TO A FRIEND

SPIB

Spi-B transcription factor (Spi-1/PU.1 related)

Synonyms: SPI-B
UniProtKB ID: Q01892, A8K9C9, B4DUG6, Q15359
Gene ID:
Human(6689) Summary: The protein encoded by this gene is a transcriptional activator that binds to the PU-box (5'-GAGGAA-3') and acts as a lymphoid-specific enhancer. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(272382) Spi-B transcription factor (Spi-1/PU.1 related)
Rat(499146) Spi-B transcription factor (Spi-1/PU.1 related)
cow(784460) Spi-B transcription factor (Spi-1/PU.1 related)
domestic guinea pig(100719396) Spi-B transcription factor (Spi-1/PU.1 related)
naked mole-rat(101699321) Spi-B transcription factor (Spi-1/PU.1 related)
dog(100688036) Spi-B transcription factor (Spi-1/PU.1 related)
domestic cat(101089815) Spi-B transcription factor (Spi-1/PU.1 related)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA018523 Anti-SPIB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV31422 Anti-SPIB antibody produced in rabbit affinity isolated antibody zebrafish, canine, rat, rabbit, guinea pig, mouse, bovine, horse, human
western blot pricing
SAB2104579 Anti-SPIB antibody produced in rabbit affinity isolated antibody rabbit, human, mouse, rat, horse, canine, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003121 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030231 MISSION® esiRNA esiRNA human SPIB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003121 Rosetta Predictions human pricing
NM_001024286 Rosetta Predictions rat pricing
NM_019866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158814 predicted 317
2 SASI_Hs01_00158815 predicted 1104
3 SASI_Hs01_00158816 predicted 867
4 SASI_Hs01_00158817 predicted 916
5 SASI_Hs01_00158818 predicted 709
6 SASI_Hs01_00158819 predicted 1106
7 SASI_Hs01_00158820 predicted 742
8 SASI_Hs01_00158821 predicted 875
9 SASI_Hs01_00158822 predicted 1103
10 SASI_Hs02_00335105 predicted 319
11 SASI_Hs01_00158813 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067621 predicted 1244
2 SASI_Rn01_00067622 predicted 1047
3 SASI_Rn01_00067623 predicted 264
4 SASI_Rn01_00067624 predicted 1075
5 SASI_Rn01_00067625 predicted 1173
6 SASI_Rn01_00067626 predicted 1190
7 SASI_Rn01_00067627 predicted 1057
8 SASI_Rn01_00067628 predicted 737
9 SASI_Rn02_00202470 predicted 529
10 SASI_Rn01_00067629 predicted 679
11 SASI_Rn01_00067630 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021744 predicted 739
2 SASI_Mm01_00021745 predicted 211
3 SASI_Mm01_00021746 predicted 32
4 SASI_Mm01_00021747 predicted 1150
5 SASI_Mm02_00325167 predicted 879
6 SASI_Mm01_00021748 predicted 1067
7 SASI_Mm01_00021749 predicted 343
8 SASI_Mm01_00021750 predicted 100
9 SASI_Mm01_00021751 predicted 1079
10 SASI_Mm01_00021752 predicted 1052
11 SASI_Mm01_00021753 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003121
SPIB MISSION shRNA Bacterial Glycerol Stock
Spi-B transcription factor (Spi-1/PU.1 related)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-38s1c1
Sequence:CCGGGCCACACTTCAGCTGTCTGTACTCGAGTACAGACAGCTGAAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003121.1-994s1c1
Sequence:CCGGCCTCTGGGATTTCTTTGTCATCTCGAGATGACAAAGAAATCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-387s1c1
Sequence:CCGGCTATCAGAGGAGGAAGACTTACTCGAGTAAGTCTTCCTCCTCTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-484s1c1
Sequence:CCGGGATCCGAGGGACTCGCAAGAACTCGAGTTCTTGCGAGTCCCTCGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-67s1c1
Sequence:CCGGGCGTCTTCTATGACCTGGACACTCGAGTGTCCAGGTCATAGAAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003121.3-1283s21c1
Sequence:CCGGGATCTGAGATTTCCTAGTTATCTCGAGATAACTAGGAAATCTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003121.3-682s21c1
Sequence:CCGGCAAGCGCATGACCTACCAGAACTCGAGTTCTGGTAGGTCATGCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003121.3-114s21c1
Sequence:CCGGAGCATTCCAGCTACCCTGATTCTCGAGAATCAGGGTAGCTGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003121.3-901s21c1
Sequence:CCGGACTCTAGGTGATAGGACTTACCTCGAGGTAAGTCCTATCACCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003121
SPIB MISSION shRNA shRNA Plasmid DNA
Spi-B transcription factor (Spi-1/PU.1 related)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-38s1c1
Sequence:CCGGGCCACACTTCAGCTGTCTGTACTCGAGTACAGACAGCTGAAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003121.1-994s1c1
Sequence:CCGGCCTCTGGGATTTCTTTGTCATCTCGAGATGACAAAGAAATCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-387s1c1
Sequence:CCGGCTATCAGAGGAGGAAGACTTACTCGAGTAAGTCTTCCTCCTCTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-484s1c1
Sequence:CCGGGATCCGAGGGACTCGCAAGAACTCGAGTTCTTGCGAGTCCCTCGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-67s1c1
Sequence:CCGGGCGTCTTCTATGACCTGGACACTCGAGTGTCCAGGTCATAGAAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003121.3-1283s21c1
Sequence:CCGGGATCTGAGATTTCCTAGTTATCTCGAGATAACTAGGAAATCTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003121.3-682s21c1
Sequence:CCGGCAAGCGCATGACCTACCAGAACTCGAGTTCTGGTAGGTCATGCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003121.3-114s21c1
Sequence:CCGGAGCATTCCAGCTACCCTGATTCTCGAGAATCAGGGTAGCTGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003121.3-901s21c1
Sequence:CCGGACTCTAGGTGATAGGACTTACCTCGAGGTAAGTCCTATCACCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003121
SPIB MISSION shRNA Lentiviral Transduction Particles
Spi-B transcription factor (Spi-1/PU.1 related)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-38s1c1
Sequence:CCGGGCCACACTTCAGCTGTCTGTACTCGAGTACAGACAGCTGAAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003121.1-994s1c1
Sequence:CCGGCCTCTGGGATTTCTTTGTCATCTCGAGATGACAAAGAAATCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-387s1c1
Sequence:CCGGCTATCAGAGGAGGAAGACTTACTCGAGTAAGTCTTCCTCCTCTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-484s1c1
Sequence:CCGGGATCCGAGGGACTCGCAAGAACTCGAGTTCTTGCGAGTCCCTCGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003121.1-67s1c1
Sequence:CCGGGCGTCTTCTATGACCTGGACACTCGAGTGTCCAGGTCATAGAAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003121.3-1283s21c1
Sequence:CCGGGATCTGAGATTTCCTAGTTATCTCGAGATAACTAGGAAATCTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003121.3-682s21c1
Sequence:CCGGCAAGCGCATGACCTACCAGAACTCGAGTTCTGGTAGGTCATGCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003121.3-114s21c1
Sequence:CCGGAGCATTCCAGCTACCCTGATTCTCGAGAATCAGGGTAGCTGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003121.3-901s21c1
Sequence:CCGGACTCTAGGTGATAGGACTTACCTCGAGGTAAGTCCTATCACCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019866
SPIB MISSION shRNA Bacterial Glycerol Stock
Spi-B transcription factor (Spi-1/PU.1 related)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019866.1-1984s1c1
Sequence:CCGGGCCTCTCAAATGCTGGGATTACTCGAGTAATCCCAGCATTTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-409s1c1
Sequence:CCGGCCTGTGCTATCAGAGGAAGAACTCGAGTTCTTCCTCTGATAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-755s1c1
Sequence:CCGGGCAAGGTCAAACGCAAACTCACTCGAGTGAGTTTGCGTTTGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-233s1c1
Sequence:CCGGCCCAAACTGTTCAGCTCTGTTCTCGAGAACAGAGCTGAACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-690s1c1
Sequence:CCGGCAAGCGCATGACGTATCAGAACTCGAGTTCTGATACGTCATGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019866
SPIB MISSION shRNA shRNA Plasmid DNA
Spi-B transcription factor (Spi-1/PU.1 related)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019866.1-1984s1c1
Sequence:CCGGGCCTCTCAAATGCTGGGATTACTCGAGTAATCCCAGCATTTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-409s1c1
Sequence:CCGGCCTGTGCTATCAGAGGAAGAACTCGAGTTCTTCCTCTGATAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-755s1c1
Sequence:CCGGGCAAGGTCAAACGCAAACTCACTCGAGTGAGTTTGCGTTTGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-233s1c1
Sequence:CCGGCCCAAACTGTTCAGCTCTGTTCTCGAGAACAGAGCTGAACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-690s1c1
Sequence:CCGGCAAGCGCATGACGTATCAGAACTCGAGTTCTGATACGTCATGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019866
SPIB MISSION shRNA Lentiviral Transduction Particles
Spi-B transcription factor (Spi-1/PU.1 related)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019866.1-1984s1c1
Sequence:CCGGGCCTCTCAAATGCTGGGATTACTCGAGTAATCCCAGCATTTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-409s1c1
Sequence:CCGGCCTGTGCTATCAGAGGAAGAACTCGAGTTCTTCCTCTGATAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-755s1c1
Sequence:CCGGGCAAGGTCAAACGCAAACTCACTCGAGTGAGTTTGCGTTTGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-233s1c1
Sequence:CCGGCCCAAACTGTTCAGCTCTGTTCTCGAGAACAGAGCTGAACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019866.1-690s1c1
Sequence:CCGGCAAGCGCATGACGTATCAGAACTCGAGTTCTGATACGTCATGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks