EMAIL THIS PAGE TO A FRIEND

SPIC

Spi-C transcription factor (Spi-1/PU.1 related)

Synonyms: SPI-C
UniProtKB ID: Q8N5J4
Gene ID:
Mouse(20728) Spi-C transcription factor (Spi-1/PU.1 related)
Rat(314711) Spi-C transcription factor (Spi-1/PU.1 related)
Zebrafish(447882) Spi-C transcription factor (Spi-1/PU.1 related)
chicken(427915) Spi-C transcription factor (Spi-1/PU.1 related)
domestic cat(101099226) Spi-C transcription factor (Spi-1/PU.1 related)
dog(612169) Spi-C transcription factor (Spi-1/PU.1 related)
naked mole-rat(101728512) Spi-C transcription factor (Spi-1/PU.1 related)
domestic guinea pig(100719534) Spi-C transcription factor (Spi-1/PU.1 related)
cow(616438) Spi-C transcription factor (Spi-1/PU.1 related)
sheep(101107344) Spi-C transcription factor (Spi-1/PU.1 related)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152323 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152323 Rosetta Predictions human pricing
NM_001108080 Rosetta Predictions rat pricing
NM_011461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198796 predicted 542
2 SASI_Hs01_00198797 predicted 619
3 SASI_Hs01_00198798 predicted 574
4 SASI_Hs01_00198799 predicted 663
5 SASI_Hs01_00198800 predicted 428
6 SASI_Hs01_00198801 predicted 648
7 SASI_Hs01_00198802 predicted 343
8 SASI_Hs01_00198803 predicted 661
9 SASI_Hs01_00198804 predicted 398
10 SASI_Hs01_00198805 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235154 predicted 354
2 SASI_Rn02_00235155 predicted 601
3 SASI_Rn02_00235156 predicted 903
4 SASI_Rn02_00235157 predicted 799
5 SASI_Rn02_00235158 predicted 361
6 SASI_Rn02_00235159 predicted 606
7 SASI_Rn02_00235160 predicted 900
8 SASI_Rn02_00235161 predicted 369
9 SASI_Rn02_00235162 predicted 890
10 SASI_Rn02_00235163 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070763 predicted 697
2 SASI_Mm01_00070764 predicted 275
3 SASI_Mm01_00070765 predicted 336
4 SASI_Mm01_00070766 predicted 617
5 SASI_Mm01_00070767 predicted 392
6 SASI_Mm01_00070768 predicted 263
7 SASI_Mm01_00070769 predicted 581
8 SASI_Mm02_00320714 predicted 381
9 SASI_Mm01_00070770 predicted 324
10 SASI_Mm01_00070772 predicted 527
11 SASI_Mm01_00070771 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011461
SPIC MISSION shRNA Bacterial Glycerol Stock
Spi-C transcription factor (Spi-1/PU.1 related)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011461.3-249s21c1
Sequence:CCGGGAAATTACATGGCTATCATTACTCGAGTAATGATAGCCATGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011461.3-338s21c1
Sequence:CCGGGACTGGAGAGGTGTAACAAATCTCGAGATTTGTTACACCTCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011461.2-1102s1c1
Sequence:CCGGGCAGACACTTTGCTATTTCTACTCGAGTAGAAATAGCAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-291s1c1
Sequence:CCGGCAACGCTAACTACTATGGAATCTCGAGATTCCATAGTAGTTAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-813s1c1
Sequence:CCGGCCTCAGTTTAAACCACTGGAACTCGAGTTCCAGTGGTTTAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-190s1c1
Sequence:CCGGGCCATTGACATATTGATCCAACTCGAGTTGGATCAATATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-290s1c1
Sequence:CCGGGCAACGCTAACTACTATGGAACTCGAGTTCCATAGTAGTTAGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011461
SPIC MISSION shRNA shRNA Plasmid DNA
Spi-C transcription factor (Spi-1/PU.1 related)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011461.3-249s21c1
Sequence:CCGGGAAATTACATGGCTATCATTACTCGAGTAATGATAGCCATGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011461.3-338s21c1
Sequence:CCGGGACTGGAGAGGTGTAACAAATCTCGAGATTTGTTACACCTCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011461.2-1102s1c1
Sequence:CCGGGCAGACACTTTGCTATTTCTACTCGAGTAGAAATAGCAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-291s1c1
Sequence:CCGGCAACGCTAACTACTATGGAATCTCGAGATTCCATAGTAGTTAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-813s1c1
Sequence:CCGGCCTCAGTTTAAACCACTGGAACTCGAGTTCCAGTGGTTTAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-190s1c1
Sequence:CCGGGCCATTGACATATTGATCCAACTCGAGTTGGATCAATATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-290s1c1
Sequence:CCGGGCAACGCTAACTACTATGGAACTCGAGTTCCATAGTAGTTAGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011461
SPIC MISSION shRNA Lentiviral Transduction Particles
Spi-C transcription factor (Spi-1/PU.1 related)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011461.3-249s21c1
Sequence:CCGGGAAATTACATGGCTATCATTACTCGAGTAATGATAGCCATGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011461.3-338s21c1
Sequence:CCGGGACTGGAGAGGTGTAACAAATCTCGAGATTTGTTACACCTCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011461.2-1102s1c1
Sequence:CCGGGCAGACACTTTGCTATTTCTACTCGAGTAGAAATAGCAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-291s1c1
Sequence:CCGGCAACGCTAACTACTATGGAATCTCGAGATTCCATAGTAGTTAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-813s1c1
Sequence:CCGGCCTCAGTTTAAACCACTGGAACTCGAGTTCCAGTGGTTTAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-190s1c1
Sequence:CCGGGCCATTGACATATTGATCCAACTCGAGTTGGATCAATATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011461.2-290s1c1
Sequence:CCGGGCAACGCTAACTACTATGGAACTCGAGTTCCATAGTAGTTAGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152323
SPIC MISSION shRNA Bacterial Glycerol Stock
Spi-C transcription factor (Spi-1/PU.1 related)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-579s21c1
Sequence:CCGGATCCGGAGGAAGCTGACTTACCTCGAGGTAAGTCAGCTTCCTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-226s21c1
Sequence:CCGGGAACGGTAATTAACAGTGCTGCTCGAGCAGCACTGTTAATTACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-668s21c1
Sequence:CCGGACAGTGTGTTCAACCTGATCACTCGAGTGATCAGGTTGAACACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-374s1c1
Sequence:CCGGCCTTCACGAATCCCTGTATAACTCGAGTTATACAGGGATTCGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-738s1c1
Sequence:CCGGGCCAATTACCATGAGCTAAATCTCGAGATTTAGCTCATGGTAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-405s1c1
Sequence:CCGGGCATCTTGTATTCAGTGGGTACTCGAGTACCCACTGAATACAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-116s1c1
Sequence:CCGGCTCGCCAGATTACAGAAATTACTCGAGTAATTTCTGTAATCTGGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-620s1c1
Sequence:CCGGCCAAAGACTCTCTCCATCCTACTCGAGTAGGATGGAGAGAGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152323
SPIC MISSION shRNA shRNA Plasmid DNA
Spi-C transcription factor (Spi-1/PU.1 related)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-579s21c1
Sequence:CCGGATCCGGAGGAAGCTGACTTACCTCGAGGTAAGTCAGCTTCCTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-226s21c1
Sequence:CCGGGAACGGTAATTAACAGTGCTGCTCGAGCAGCACTGTTAATTACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-668s21c1
Sequence:CCGGACAGTGTGTTCAACCTGATCACTCGAGTGATCAGGTTGAACACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-374s1c1
Sequence:CCGGCCTTCACGAATCCCTGTATAACTCGAGTTATACAGGGATTCGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-738s1c1
Sequence:CCGGGCCAATTACCATGAGCTAAATCTCGAGATTTAGCTCATGGTAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-405s1c1
Sequence:CCGGGCATCTTGTATTCAGTGGGTACTCGAGTACCCACTGAATACAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-116s1c1
Sequence:CCGGCTCGCCAGATTACAGAAATTACTCGAGTAATTTCTGTAATCTGGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-620s1c1
Sequence:CCGGCCAAAGACTCTCTCCATCCTACTCGAGTAGGATGGAGAGAGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152323
SPIC MISSION shRNA Lentiviral Transduction Particles
Spi-C transcription factor (Spi-1/PU.1 related)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-579s21c1
Sequence:CCGGATCCGGAGGAAGCTGACTTACCTCGAGGTAAGTCAGCTTCCTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-226s21c1
Sequence:CCGGGAACGGTAATTAACAGTGCTGCTCGAGCAGCACTGTTAATTACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152323.1-668s21c1
Sequence:CCGGACAGTGTGTTCAACCTGATCACTCGAGTGATCAGGTTGAACACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-374s1c1
Sequence:CCGGCCTTCACGAATCCCTGTATAACTCGAGTTATACAGGGATTCGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-738s1c1
Sequence:CCGGGCCAATTACCATGAGCTAAATCTCGAGATTTAGCTCATGGTAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-405s1c1
Sequence:CCGGGCATCTTGTATTCAGTGGGTACTCGAGTACCCACTGAATACAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-116s1c1
Sequence:CCGGCTCGCCAGATTACAGAAATTACTCGAGTAATTTCTGTAATCTGGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152323.1-620s1c1
Sequence:CCGGCCAAAGACTCTCTCCATCCTACTCGAGTAGGATGGAGAGAGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks