EMAIL THIS PAGE TO A FRIEND

SPICE1

spindle and centriole associated protein 1

Synonyms: CCDC52 SPICE
UniProtKB ID: Q8N0Z3, D3DN72, Q8WUX6
Gene ID:
Mouse(212514) spindle and centriole associated protein 1
Rat(288111) spindle and centriole associated protein 1
cow(515350) spindle and centriole associated protein 1
sheep(101123340) spindle and centriole associated protein 1
domestic guinea pig(100713281) spindle and centriole associated protein 1
naked mole-rat(101697906) spindle and centriole associated protein 1
Domestic Rabbit(100346993) spindle and centriole associated protein 1
Zebrafish(494093) spindle and centriole associated protein 1
chicken(418322) spindle and centriole associated protein 1
domestic cat(101090381) spindle and centriole associated protein 1
Horse(100061337) spindle and centriole associated protein 1
dog(478568) spindle and centriole associated protein 1
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103049 Anti-CCDC52 antibody produced in rabbit affinity isolated antibody human, canine, horse, guinea pig, rat, bovine, mouse, rabbit
western blot pricing
SAB2103048 Anti-CCDC52, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, rabbit, canine, horse, bovine, human, mouse
western blot pricing
HPA064843 Anti-SPICE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144718 Rosetta Predictions human pricing
NM_001008285 Rosetta Predictions rat pricing
NM_144550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364659 predicted 714
2 SASI_Hs01_00234986 predicted 427
3 SASI_Hs01_00234988 predicted 1999
4 SASI_Hs01_00234989 predicted 897
5 SASI_Hs01_00234990 predicted 736
6 SASI_Hs01_00234991 predicted 2587
7 SASI_Hs01_00234992 predicted 2414
8 SASI_Hs01_00234993 predicted 828
9 SASI_Hs01_00234994 predicted 2426
10 SASI_Hs01_00234995 predicted 1422
11 SASI_Hs01_00234987 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033511 predicted 664
2 SASI_Rn01_00033512 predicted 595
3 SASI_Rn01_00033513 predicted 1228
4 SASI_Rn01_00033514 predicted 484
5 SASI_Rn01_00033515 predicted 301
6 SASI_Rn01_00033516 predicted 1774
7 SASI_Rn01_00033517 predicted 500
8 SASI_Rn01_00033518 predicted 613
9 SASI_Rn01_00033519 predicted 2276
10 SASI_Rn01_00033520 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340088 predicted 1465
2 SASI_Mm01_00101146 predicted 327
3 SASI_Mm01_00101147 predicted 528
4 SASI_Mm01_00101148 predicted 1609
5 SASI_Mm01_00101149 predicted 1258
6 SASI_Mm01_00101150 predicted 1455
7 SASI_Mm01_00101151 predicted 689
8 SASI_Mm01_00101152 predicted 682
9 SASI_Mm01_00101153 predicted 1805
10 SASI_Mm01_00101154 predicted 214
11 SASI_Mm01_00101155 predicted 1515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144718
VALIDATED
SPICE1 MISSION shRNA Bacterial Glycerol Stock
spindle and centriole associated protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144718.2-3773s1c1
Sequence:CCGGGCCCAGCTAATTTGTGTATTTCTCGAGAAATACACAAATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144718.2-4892s1c1
Sequence:CCGGCCCATTTGAAAGTCAGACATACTCGAGTATGTCTGACTTTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144718.2-4559s1c1
Sequence:CCGGCCGTACTATAAGCTGTGGTATCTCGAGATACCACAGCTTATAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144718.2-4859s1c1
Sequence:CCGGGCTGCGTACTTTGGACAAATTCTCGAGAATTTGTCCAAAGTACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144718.2-2225s1c1
Sequence:CCGGGCTGAGAACAAATGAGTCATTCTCGAGAATGACTCATTTGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144718.2-2254s1c1
Sequence:CCGGGAAAGGACATAATGACACGAACTCGAGTTCGTGTCATTATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144718.2-366s1c1
Sequence:CCGGGTGACTGATCTAACCGTTCATCTCGAGATGAACGGTTAGATCAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-875s21c1
Sequence:CCGGACTCTCAGTCTAACACGAATACTCGAGTATTCGTGTTAGACTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-2626s21c1
Sequence:CCGGAGGACAATTGAGGTATCTATTCTCGAGAATAGATACCTCAATTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144718.3-2965s21c1
Sequence:CCGGATCCTGTGAATTAGTACTAATCTCGAGATTAGTACTAATTCACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-1257s21c1
Sequence:CCGGCTTACCAAATAGGACTAATTCCTCGAGGAATTAGTCCTATTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-1644s21c1
Sequence:CCGGGAACTGTCCTGTGATAAATAACTCGAGTTATTTATCACAGGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-443s21c1
Sequence:CCGGGCCGTCATGAAATACACAAATCTCGAGATTTGTGTATTTCATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144718.3-3231s21c1
Sequence:CCGGCTAATTTGCTTTGCATGTAACCTCGAGGTTACATGCAAAGCAAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144718
VALIDATED
SPICE1 MISSION shRNA shRNA Plasmid DNA
spindle and centriole associated protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144718.2-3773s1c1
Sequence:CCGGGCCCAGCTAATTTGTGTATTTCTCGAGAAATACACAAATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144718.2-4892s1c1
Sequence:CCGGCCCATTTGAAAGTCAGACATACTCGAGTATGTCTGACTTTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144718.2-4559s1c1
Sequence:CCGGCCGTACTATAAGCTGTGGTATCTCGAGATACCACAGCTTATAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144718.2-4859s1c1
Sequence:CCGGGCTGCGTACTTTGGACAAATTCTCGAGAATTTGTCCAAAGTACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144718.2-2225s1c1
Sequence:CCGGGCTGAGAACAAATGAGTCATTCTCGAGAATGACTCATTTGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144718.2-2254s1c1
Sequence:CCGGGAAAGGACATAATGACACGAACTCGAGTTCGTGTCATTATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144718.2-366s1c1
Sequence:CCGGGTGACTGATCTAACCGTTCATCTCGAGATGAACGGTTAGATCAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-875s21c1
Sequence:CCGGACTCTCAGTCTAACACGAATACTCGAGTATTCGTGTTAGACTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-2626s21c1
Sequence:CCGGAGGACAATTGAGGTATCTATTCTCGAGAATAGATACCTCAATTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144718.3-2965s21c1
Sequence:CCGGATCCTGTGAATTAGTACTAATCTCGAGATTAGTACTAATTCACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-1257s21c1
Sequence:CCGGCTTACCAAATAGGACTAATTCCTCGAGGAATTAGTCCTATTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-1644s21c1
Sequence:CCGGGAACTGTCCTGTGATAAATAACTCGAGTTATTTATCACAGGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-443s21c1
Sequence:CCGGGCCGTCATGAAATACACAAATCTCGAGATTTGTGTATTTCATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144718.3-3231s21c1
Sequence:CCGGCTAATTTGCTTTGCATGTAACCTCGAGGTTACATGCAAAGCAAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144718
VALIDATED
SPICE1 MISSION shRNA Lentiviral Transduction Particles
spindle and centriole associated protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144718.2-3773s1c1
Sequence:CCGGGCCCAGCTAATTTGTGTATTTCTCGAGAAATACACAAATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144718.2-4892s1c1
Sequence:CCGGCCCATTTGAAAGTCAGACATACTCGAGTATGTCTGACTTTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144718.2-4559s1c1
Sequence:CCGGCCGTACTATAAGCTGTGGTATCTCGAGATACCACAGCTTATAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144718.2-4859s1c1
Sequence:CCGGGCTGCGTACTTTGGACAAATTCTCGAGAATTTGTCCAAAGTACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144718.2-2225s1c1
Sequence:CCGGGCTGAGAACAAATGAGTCATTCTCGAGAATGACTCATTTGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144718.2-2254s1c1
Sequence:CCGGGAAAGGACATAATGACACGAACTCGAGTTCGTGTCATTATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_144718.2-366s1c1
Sequence:CCGGGTGACTGATCTAACCGTTCATCTCGAGATGAACGGTTAGATCAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-875s21c1
Sequence:CCGGACTCTCAGTCTAACACGAATACTCGAGTATTCGTGTTAGACTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-2626s21c1
Sequence:CCGGAGGACAATTGAGGTATCTATTCTCGAGAATAGATACCTCAATTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144718.3-2965s21c1
Sequence:CCGGATCCTGTGAATTAGTACTAATCTCGAGATTAGTACTAATTCACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-1257s21c1
Sequence:CCGGCTTACCAAATAGGACTAATTCCTCGAGGAATTAGTCCTATTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-1644s21c1
Sequence:CCGGGAACTGTCCTGTGATAAATAACTCGAGTTATTTATCACAGGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144718.3-443s21c1
Sequence:CCGGGCCGTCATGAAATACACAAATCTCGAGATTTGTGTATTTCATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144718.3-3231s21c1
Sequence:CCGGCTAATTTGCTTTGCATGTAACCTCGAGGTTACATGCAAAGCAAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144550
VALIDATED
SPICE1 MISSION shRNA Bacterial Glycerol Stock
spindle and centriole associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144550.2-1811s1c1
Sequence:CCGGCCTGCCTATTGATCCAGACATCTCGAGATGTCTGGATCAATAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144550.2-2185s1c1
Sequence:CCGGGTGCCAGTGAAGTGTCTACTACTCGAGTAGTAGACACTTCACTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144550.2-2749s1c1
Sequence:CCGGCCTGTATTTATGGAAACAGAACTCGAGTTCTGTTTCCATAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144550.2-1197s1c1
Sequence:CCGGCGGTACCTTAAAGAGAGTGAACTCGAGTTCACTCTCTTTAAGGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144550.2-3672s1c1
Sequence:CCGGCCTCAGAACATAGGAAACATACTCGAGTATGTTTCCTATGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-2189s21c1
Sequence:CCGGCAGTGAAGTGTCTACTAATTTCTCGAGAAATTAGTAGACACTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-130s21c1
Sequence:CCGGTGAGGCAAGAATGGGATAATACTCGAGTATTATCCCATTCTTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-2810s21c1
Sequence:CCGGTCAACAAAGCACCTCTAATTCCTCGAGGAATTAGAGGTGCTTTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144550.3-706s21c1
Sequence:CCGGATCAACTGTGGACTGATATTCCTCGAGGAATATCAGTCCACAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-662s21c1
Sequence:CCGGGAGGTTTCTTCACCAACTAAACTCGAGTTTAGTTGGTGAAGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144550
VALIDATED
SPICE1 MISSION shRNA shRNA Plasmid DNA
spindle and centriole associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144550.2-1811s1c1
Sequence:CCGGCCTGCCTATTGATCCAGACATCTCGAGATGTCTGGATCAATAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144550.2-2185s1c1
Sequence:CCGGGTGCCAGTGAAGTGTCTACTACTCGAGTAGTAGACACTTCACTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144550.2-2749s1c1
Sequence:CCGGCCTGTATTTATGGAAACAGAACTCGAGTTCTGTTTCCATAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144550.2-1197s1c1
Sequence:CCGGCGGTACCTTAAAGAGAGTGAACTCGAGTTCACTCTCTTTAAGGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144550.2-3672s1c1
Sequence:CCGGCCTCAGAACATAGGAAACATACTCGAGTATGTTTCCTATGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-2189s21c1
Sequence:CCGGCAGTGAAGTGTCTACTAATTTCTCGAGAAATTAGTAGACACTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-130s21c1
Sequence:CCGGTGAGGCAAGAATGGGATAATACTCGAGTATTATCCCATTCTTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-2810s21c1
Sequence:CCGGTCAACAAAGCACCTCTAATTCCTCGAGGAATTAGAGGTGCTTTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144550.3-706s21c1
Sequence:CCGGATCAACTGTGGACTGATATTCCTCGAGGAATATCAGTCCACAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-662s21c1
Sequence:CCGGGAGGTTTCTTCACCAACTAAACTCGAGTTTAGTTGGTGAAGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144550
VALIDATED
SPICE1 MISSION shRNA Lentiviral Transduction Particles
spindle and centriole associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144550.2-1811s1c1
Sequence:CCGGCCTGCCTATTGATCCAGACATCTCGAGATGTCTGGATCAATAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144550.2-2185s1c1
Sequence:CCGGGTGCCAGTGAAGTGTCTACTACTCGAGTAGTAGACACTTCACTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144550.2-2749s1c1
Sequence:CCGGCCTGTATTTATGGAAACAGAACTCGAGTTCTGTTTCCATAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144550.2-1197s1c1
Sequence:CCGGCGGTACCTTAAAGAGAGTGAACTCGAGTTCACTCTCTTTAAGGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144550.2-3672s1c1
Sequence:CCGGCCTCAGAACATAGGAAACATACTCGAGTATGTTTCCTATGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-2189s21c1
Sequence:CCGGCAGTGAAGTGTCTACTAATTTCTCGAGAAATTAGTAGACACTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-130s21c1
Sequence:CCGGTGAGGCAAGAATGGGATAATACTCGAGTATTATCCCATTCTTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-2810s21c1
Sequence:CCGGTCAACAAAGCACCTCTAATTCCTCGAGGAATTAGAGGTGCTTTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144550.3-706s21c1
Sequence:CCGGATCAACTGTGGACTGATATTCCTCGAGGAATATCAGTCCACAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144550.3-662s21c1
Sequence:CCGGGAGGTTTCTTCACCAACTAAACTCGAGTTTAGTTGGTGAAGAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks