EMAIL THIS PAGE TO A FRIEND

SPIDR

scaffolding protein involved in DNA repair

Synonyms: KIAA0146
Gene ID:
Mouse(224008) scaffolding protein involved i DNA repair
Rat(498119) scaffolding protein involved in DNA repair
cow(512910) scaffolding protein involved in DNA repair
231 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080394 Rosetta Predictions human pricing
NM_001100988 Rosetta Predictions rat pricing
NM_146068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314431 predicted 652
2 SASI_Hs02_00314432 predicted 365
3 SASI_Hs02_00314433 predicted 1942
4 SASI_Hs02_00314434 predicted 1874
5 SASI_Hs02_00314435 predicted 1133
6 SASI_Hs02_00314436 predicted 293
7 SASI_Hs02_00314437 predicted 349
8 SASI_Hs02_00314438 predicted 2475
9 SASI_Hs02_00314439 predicted 1559
10 SASI_Hs02_00314440 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211022 predicted 2462
2 SASI_Rn02_00211023 predicted 2242
3 SASI_Rn02_00211024 predicted 538
4 SASI_Rn02_00211025 predicted 744
5 SASI_Rn02_00211026 predicted 1842
6 SASI_Rn02_00211027 predicted 1868
7 SASI_Rn02_00211028 predicted 1046
8 SASI_Rn02_00211029 predicted 2096
9 SASI_Rn02_00211030 predicted 1129
10 SASI_Rn02_00211031 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140249 predicted 1306
2 SASI_Mm01_00140250 predicted 1943
3 SASI_Mm01_00140252 predicted 2021
4 SASI_Mm01_00140253 predicted 1372
5 SASI_Mm01_00140254 predicted 2145
6 SASI_Mm02_00341689 predicted 1989
7 SASI_Mm01_00140255 predicted 1237
8 SASI_Mm01_00140256 predicted 483
9 SASI_Mm01_00140257 predicted 2625
10 SASI_Mm01_00140258 predicted 2044
11 SASI_Mm01_00140251 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146068
VALIDATED
SPIDR MISSION shRNA Bacterial Glycerol Stock
scaffolding protein involved in DNA repair
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-1309s21c1
Sequence:CCGGACCTATACAGTCCGGACATATCTCGAGATATGTCCGGACTGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-2939s21c1
Sequence:CCGGTTCTGGTAAAGAGATTAATAGCTCGAGCTATTAATCTCTTTACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-486s21c1
Sequence:CCGGGAAGATGAATTACAGGTTATTCTCGAGAATAACCTGTAATTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-1464s21c1
Sequence:CCGGGCAGAGCAACATCTTATAGTTCTCGAGAACTATAAGATGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-851s21c1
Sequence:CCGGTCCGAAGACTCCAGAATATTCCTCGAGGAATATTCTGGAGTCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-1247s1c1
Sequence:CCGGGCTCCATTATTCTGAATACTTCTCGAGAAGTATTCAGAATAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-3092s1c1
Sequence:CCGGGCTTAGGAAATGTGCTTTGTTCTCGAGAACAAAGCACATTTCCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-1465s1c1
Sequence:CCGGGCAGAGCAACATCTTATAGTTCTCGAGAACTATAAGATGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-282s1c1
Sequence:CCGGGCACCTGGAATTATCTCCAAACTCGAGTTTGGAGATAATTCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146068.2-2221s1c1
Sequence:CCGGCCAGAGGTTGTAGAAGAACTTCTCGAGAAGTTCTTCTACAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146068
VALIDATED
SPIDR MISSION shRNA shRNA Plasmid DNA
scaffolding protein involved in DNA repair
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-1309s21c1
Sequence:CCGGACCTATACAGTCCGGACATATCTCGAGATATGTCCGGACTGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-2939s21c1
Sequence:CCGGTTCTGGTAAAGAGATTAATAGCTCGAGCTATTAATCTCTTTACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-486s21c1
Sequence:CCGGGAAGATGAATTACAGGTTATTCTCGAGAATAACCTGTAATTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-1464s21c1
Sequence:CCGGGCAGAGCAACATCTTATAGTTCTCGAGAACTATAAGATGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-851s21c1
Sequence:CCGGTCCGAAGACTCCAGAATATTCCTCGAGGAATATTCTGGAGTCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-1247s1c1
Sequence:CCGGGCTCCATTATTCTGAATACTTCTCGAGAAGTATTCAGAATAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-3092s1c1
Sequence:CCGGGCTTAGGAAATGTGCTTTGTTCTCGAGAACAAAGCACATTTCCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-1465s1c1
Sequence:CCGGGCAGAGCAACATCTTATAGTTCTCGAGAACTATAAGATGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-282s1c1
Sequence:CCGGGCACCTGGAATTATCTCCAAACTCGAGTTTGGAGATAATTCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146068.2-2221s1c1
Sequence:CCGGCCAGAGGTTGTAGAAGAACTTCTCGAGAAGTTCTTCTACAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146068
VALIDATED
SPIDR MISSION shRNA Lentiviral Transduction Particles
scaffolding protein involved in DNA repair
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-1309s21c1
Sequence:CCGGACCTATACAGTCCGGACATATCTCGAGATATGTCCGGACTGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-2939s21c1
Sequence:CCGGTTCTGGTAAAGAGATTAATAGCTCGAGCTATTAATCTCTTTACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-486s21c1
Sequence:CCGGGAAGATGAATTACAGGTTATTCTCGAGAATAACCTGTAATTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-1464s21c1
Sequence:CCGGGCAGAGCAACATCTTATAGTTCTCGAGAACTATAAGATGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146068.3-851s21c1
Sequence:CCGGTCCGAAGACTCCAGAATATTCCTCGAGGAATATTCTGGAGTCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-1247s1c1
Sequence:CCGGGCTCCATTATTCTGAATACTTCTCGAGAAGTATTCAGAATAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-3092s1c1
Sequence:CCGGGCTTAGGAAATGTGCTTTGTTCTCGAGAACAAAGCACATTTCCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-1465s1c1
Sequence:CCGGGCAGAGCAACATCTTATAGTTCTCGAGAACTATAAGATGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146068.2-282s1c1
Sequence:CCGGGCACCTGGAATTATCTCCAAACTCGAGTTTGGAGATAATTCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146068.2-2221s1c1
Sequence:CCGGCCAGAGGTTGTAGAAGAACTTCTCGAGAAGTTCTTCTACAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080394
SPIDR MISSION shRNA Bacterial Glycerol Stock
scaffolding protein involved in DNA repair
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-1264s21c1
Sequence:CCGGGTAATTAAGGGTCTAACAAATCTCGAGATTTGTTAGACCCTTAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-1952s21c1
Sequence:CCGGGTTTCTATGCCACGGTGATTTCTCGAGAAATCACCGTGGCATAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080394.1-3028s21c1
Sequence:CCGGTTGGTATTTAGGCAATATATGCTCGAGCATATATTGCCTAAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-791s21c1
Sequence:CCGGGACTAGCAGAAAGACTAAATGCTCGAGCATTTAGTCTTTCTGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-649s21c1
Sequence:CCGGTCGGATGCAAGACAGATTATGCTCGAGCATAATCTGTCTTGCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080394
SPIDR MISSION shRNA shRNA Plasmid DNA
scaffolding protein involved in DNA repair
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-1264s21c1
Sequence:CCGGGTAATTAAGGGTCTAACAAATCTCGAGATTTGTTAGACCCTTAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-1952s21c1
Sequence:CCGGGTTTCTATGCCACGGTGATTTCTCGAGAAATCACCGTGGCATAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080394.1-3028s21c1
Sequence:CCGGTTGGTATTTAGGCAATATATGCTCGAGCATATATTGCCTAAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-791s21c1
Sequence:CCGGGACTAGCAGAAAGACTAAATGCTCGAGCATTTAGTCTTTCTGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-649s21c1
Sequence:CCGGTCGGATGCAAGACAGATTATGCTCGAGCATAATCTGTCTTGCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080394
SPIDR MISSION shRNA Lentiviral Transduction Particles
scaffolding protein involved in DNA repair
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-1264s21c1
Sequence:CCGGGTAATTAAGGGTCTAACAAATCTCGAGATTTGTTAGACCCTTAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-1952s21c1
Sequence:CCGGGTTTCTATGCCACGGTGATTTCTCGAGAAATCACCGTGGCATAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080394.1-3028s21c1
Sequence:CCGGTTGGTATTTAGGCAATATATGCTCGAGCATATATTGCCTAAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-791s21c1
Sequence:CCGGGACTAGCAGAAAGACTAAATGCTCGAGCATTTAGTCTTTCTGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080394.1-649s21c1
Sequence:CCGGTCGGATGCAAGACAGATTATGCTCGAGCATAATCTGTCTTGCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks