EMAIL THIS PAGE TO A FRIEND

SPIN1

spindlin 1

Synonyms: SPIN
UniProtKB ID: Q9Y657, A8K0X6, B3KRQ4, Q7KZJ8, Q9GZT2, Q9H0N7
Gene ID:
Mouse(20729) spindlin 1
Rat(361217) spindlin 1
dog(476353) spindlin 1
cow(541068) spindlin 1
sheep(101102870) spindlin 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006717 Rosetta Predictions human pricing
NM_001024796 Rosetta Predictions rat pricing
NM_011462 Rosetta Predictions mouse pricing
NM_146043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113708 predicted 478
2 SASI_Hs02_00342153 predicted 370
3 SASI_Hs01_00113709 predicted 1034
4 SASI_Hs01_00113710 predicted 877
5 SASI_Hs01_00113711 predicted 1184
6 SASI_Hs01_00113712 predicted 556
7 SASI_Hs01_00113713 predicted 1119
8 SASI_Hs01_00113715 predicted 466
9 SASI_Hs01_00113716 predicted 767
10 SASI_Hs02_00342154 predicted 367
11 SASI_Hs01_00113714 predicted 494
12 SASI_Hs01_00113717 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056494 predicted 721
2 SASI_Rn02_00202707 predicted 673
3 SASI_Rn01_00056495 predicted 814
4 SASI_Rn02_00202708 predicted 354
5 SASI_Rn01_00056496 predicted 484
6 SASI_Rn01_00056497 predicted 533
7 SASI_Rn01_00056498 predicted 483
8 SASI_Rn01_00056499 predicted 509
9 SASI_Rn01_00056501 predicted 303
10 SASI_Rn01_00056502 predicted 822
11 SASI_Rn01_00056500 predicted 624
12 SASI_Rn01_00056503 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320715 predicted 381
2 SASI_Mm02_00320716 predicted 302
3 SASI_Mm01_00149571 predicted 466
4 SASI_Mm02_00320717 predicted 288
5 SASI_Mm01_00149562 predicted 329
6 SASI_Mm02_00320718 predicted 529
7 SASI_Mm02_00320719 predicted 383
8 SASI_Mm01_00149563 predicted 333
9 SASI_Mm02_00320720 predicted 269
10 SASI_Mm02_00320721 predicted 297
11 SASI_Mm01_00149564 predicted 353
12 SASI_Mm01_00149565 predicted 334
13 SASI_Mm01_00149566 predicted 326
14 SASI_Mm01_00149567 predicted 349
15 SASI_Mm01_00149568 predicted 318
16 SASI_Mm01_00149569 predicted 358
17 SASI_Mm01_00149570 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341648 predicted 659
2 SASI_Mm02_00341649 predicted 578
3 SASI_Mm01_00118611 predicted 747
4 SASI_Mm02_00341650 predicted 574
5 SASI_Mm01_00118602 predicted 614
6 SASI_Mm02_00341651 predicted 810
7 SASI_Mm02_00341652 predicted 667
8 SASI_Mm01_00118603 predicted 618
9 SASI_Mm02_00341653 predicted 544
10 SASI_Mm02_00341654 predicted 577
11 SASI_Mm01_00118604 predicted 633
12 SASI_Mm01_00118605 predicted 626
13 SASI_Mm01_00118606 predicted 608
14 SASI_Mm01_00118607 predicted 635
15 SASI_Mm01_00118608 predicted 606
16 SASI_Mm01_00118609 predicted 640
17 SASI_Mm01_00118610 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011462
VALIDATED
SPIN1 MISSION shRNA Bacterial Glycerol Stock
spindlin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-705s1c1
Sequence:CCGGCGATTTCCATATTTACGTCTACTCGAGTAGACGTAAATATGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-199s1c1
Sequence:CCGGCCTGTGAATCCTTCCCTGTATCTCGAGATACAGGGAAGGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-343s1c1
Sequence:CCGGGCGGACACAATGATCGGCAAACTCGAGTTTGCCGATCATTGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-711s1c1
Sequence:CCGGCCATATTTACGTCTACGATTTCTCGAGAAATCGTAGACGTAAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-232s1c1
Sequence:CCGGGATGGATTTGACTGTGTTTATCTCGAGATAAACACAGTCAAATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-347s21c1
Sequence:CCGGGCGGACACAATGATCGGCAAACTCGAGTTTGCCGATCATTGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-709s21c1
Sequence:CCGGCGATTTCCATATTTACGTCTACTCGAGTAGACGTAAATATGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-236s21c1
Sequence:CCGGGATGGATTTGACTGTGTTTATCTCGAGATAAACACAGTCAAATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-203s21c1
Sequence:CCGGCCTGTGAATCCTTCCCTGTATCTCGAGATACAGGGAAGGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011462
VALIDATED
SPIN1 MISSION shRNA shRNA Plasmid DNA
spindlin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-705s1c1
Sequence:CCGGCGATTTCCATATTTACGTCTACTCGAGTAGACGTAAATATGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-199s1c1
Sequence:CCGGCCTGTGAATCCTTCCCTGTATCTCGAGATACAGGGAAGGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-343s1c1
Sequence:CCGGGCGGACACAATGATCGGCAAACTCGAGTTTGCCGATCATTGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-711s1c1
Sequence:CCGGCCATATTTACGTCTACGATTTCTCGAGAAATCGTAGACGTAAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-232s1c1
Sequence:CCGGGATGGATTTGACTGTGTTTATCTCGAGATAAACACAGTCAAATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-347s21c1
Sequence:CCGGGCGGACACAATGATCGGCAAACTCGAGTTTGCCGATCATTGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-709s21c1
Sequence:CCGGCGATTTCCATATTTACGTCTACTCGAGTAGACGTAAATATGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-236s21c1
Sequence:CCGGGATGGATTTGACTGTGTTTATCTCGAGATAAACACAGTCAAATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-203s21c1
Sequence:CCGGCCTGTGAATCCTTCCCTGTATCTCGAGATACAGGGAAGGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011462
VALIDATED
SPIN1 MISSION shRNA Lentiviral Transduction Particles
spindlin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-705s1c1
Sequence:CCGGCGATTTCCATATTTACGTCTACTCGAGTAGACGTAAATATGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-199s1c1
Sequence:CCGGCCTGTGAATCCTTCCCTGTATCTCGAGATACAGGGAAGGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-343s1c1
Sequence:CCGGGCGGACACAATGATCGGCAAACTCGAGTTTGCCGATCATTGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-711s1c1
Sequence:CCGGCCATATTTACGTCTACGATTTCTCGAGAAATCGTAGACGTAAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011462.1-232s1c1
Sequence:CCGGGATGGATTTGACTGTGTTTATCTCGAGATAAACACAGTCAAATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-347s21c1
Sequence:CCGGGCGGACACAATGATCGGCAAACTCGAGTTTGCCGATCATTGTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-709s21c1
Sequence:CCGGCGATTTCCATATTTACGTCTACTCGAGTAGACGTAAATATGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-236s21c1
Sequence:CCGGGATGGATTTGACTGTGTTTATCTCGAGATAAACACAGTCAAATCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011462.2-203s21c1
Sequence:CCGGCCTGTGAATCCTTCCCTGTATCTCGAGATACAGGGAAGGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006717
VALIDATED
SPIN1 MISSION shRNA Bacterial Glycerol Stock
spindlin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-776s1c1
Sequence:CCGGCCTGATTCCAATGATTCACCTCTCGAGAGGTGAATCATTGGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-620s1c1
Sequence:CCGGGAGACAGAGGATGGTTCTAAACTCGAGTTTAGAACCATCCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-1317s1c1
Sequence:CCGGGCCACAATGCAAGCATAGTTTCTCGAGAAACTATGCTTGCATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-1291s1c1
Sequence:CCGGCCTCACCCTAACTCTCTTATTCTCGAGAATAAGAGAGTTAGGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-277s1c1
Sequence:CCGGGAAGAAGAGGACATCCCACAACTCGAGTTGTGGGATGTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-857s1c1
Sequence:CCGGGCCAAAGAAGATGGCTCGAAACTCGAGTTTCGAGCCATCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-913s1c1
Sequence:CCGGGCCCTCCGTCTATTTCATCAACTCGAGTTGATGAAATAGACGGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-1290s1c1
Sequence:CCGGCCCTCACCCTAACTCTCTTATCTCGAGATAAGAGAGTTAGGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-575s1c1
Sequence:CCGGCACTTGGCAGACACAATGATTCTCGAGAATCATTGTGTCTGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-512s1c1
Sequence:CCGGGAAAGAGTTTCTGCGCTTGAACTCGAGTTCAAGCGCAGAAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006717
VALIDATED
SPIN1 MISSION shRNA shRNA Plasmid DNA
spindlin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-776s1c1
Sequence:CCGGCCTGATTCCAATGATTCACCTCTCGAGAGGTGAATCATTGGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-620s1c1
Sequence:CCGGGAGACAGAGGATGGTTCTAAACTCGAGTTTAGAACCATCCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-1317s1c1
Sequence:CCGGGCCACAATGCAAGCATAGTTTCTCGAGAAACTATGCTTGCATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-1291s1c1
Sequence:CCGGCCTCACCCTAACTCTCTTATTCTCGAGAATAAGAGAGTTAGGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-277s1c1
Sequence:CCGGGAAGAAGAGGACATCCCACAACTCGAGTTGTGGGATGTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-857s1c1
Sequence:CCGGGCCAAAGAAGATGGCTCGAAACTCGAGTTTCGAGCCATCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-913s1c1
Sequence:CCGGGCCCTCCGTCTATTTCATCAACTCGAGTTGATGAAATAGACGGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-1290s1c1
Sequence:CCGGCCCTCACCCTAACTCTCTTATCTCGAGATAAGAGAGTTAGGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-575s1c1
Sequence:CCGGCACTTGGCAGACACAATGATTCTCGAGAATCATTGTGTCTGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-512s1c1
Sequence:CCGGGAAAGAGTTTCTGCGCTTGAACTCGAGTTCAAGCGCAGAAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006717
VALIDATED
SPIN1 MISSION shRNA Lentiviral Transduction Particles
spindlin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-776s1c1
Sequence:CCGGCCTGATTCCAATGATTCACCTCTCGAGAGGTGAATCATTGGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-620s1c1
Sequence:CCGGGAGACAGAGGATGGTTCTAAACTCGAGTTTAGAACCATCCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-1317s1c1
Sequence:CCGGGCCACAATGCAAGCATAGTTTCTCGAGAAACTATGCTTGCATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-1291s1c1
Sequence:CCGGCCTCACCCTAACTCTCTTATTCTCGAGAATAAGAGAGTTAGGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-277s1c1
Sequence:CCGGGAAGAAGAGGACATCCCACAACTCGAGTTGTGGGATGTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-857s1c1
Sequence:CCGGGCCAAAGAAGATGGCTCGAAACTCGAGTTTCGAGCCATCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-913s1c1
Sequence:CCGGGCCCTCCGTCTATTTCATCAACTCGAGTTGATGAAATAGACGGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-1290s1c1
Sequence:CCGGCCCTCACCCTAACTCTCTTATCTCGAGATAAGAGAGTTAGGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006717.1-575s1c1
Sequence:CCGGCACTTGGCAGACACAATGATTCTCGAGAATCATTGTGTCTGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006717.1-512s1c1
Sequence:CCGGGAAAGAGTTTCTGCGCTTGAACTCGAGTTCAAGCGCAGAAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks