EMAIL THIS PAGE TO A FRIEND

SPIN2A

spindlin family, member 2A

Synonyms: DXF34 RP3-323P24.2 SPIN2 dJ323P24.1
UniProtKB ID: Q99865, O75650, Q6IPW2, Q9UJJ0
Gene ID:
Human(54466) Summary: This gene encodes one of three members of the DXF34 gene family, located in a 100-kb region of chromosome Xp11.21. [provided by RefSeq, Nov 2009]
Rat(317395) spindlin family, member 2A
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019003 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105641 MISSION® esiRNA esiRNA human SPIN2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019003 Rosetta Predictions human pricing
NM_001127657 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181992 predicted 615
2 SASI_Hs01_00181993 predicted 548
3 SASI_Hs01_00181994 predicted 636
4 SASI_Hs02_00352516 predicted 714
5 SASI_Hs01_00181996 predicted 881
6 SASI_Hs01_00181997 predicted 730
7 SASI_Hs01_00181999 predicted 597
8 SASI_Hs01_00182000 predicted 1060
9 SASI_Hs01_00182001 predicted 1044
10 SASI_Hs02_00352517 predicted 709
11 SASI_Hs01_00181995 predicted 825
12 SASI_Hs01_00181998 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254800 predicted 776
2 SASI_Rn02_00254801 predicted 650
3 SASI_Rn02_00254802 predicted 567
4 SASI_Rn02_00254803 predicted 655
5 SASI_Rn02_00254804 predicted 457
6 SASI_Rn02_00254805 predicted 678
7 SASI_Rn02_00254806 predicted 769
8 SASI_Rn02_00254807 predicted 552
9 SASI_Rn02_00254808 predicted 592
10 SASI_Rn02_00254809 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019003
SPIN2A MISSION shRNA Bacterial Glycerol Stock
spindlin family, member 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019003.2-1170s1c1
Sequence:CCGGCATGTGTGGAAACAAATGTATCTCGAGATACATTTGTTTCCACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-744s1c1
Sequence:CCGGGCAAATACCATAATTGGCAAACTCGAGTTTGCCAATTATGGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-837s1c1
Sequence:CCGGCCTATCATGAAAGCCTGGTTTCTCGAGAAACCAGGCTTTCATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-723s1c1
Sequence:CCGGCACATTAGTGATGCCAACCTTCTCGAGAAGGTTGGCATCACTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-609s1c1
Sequence:CCGGCCCTCTCTTTATCTGGTGAAACTCGAGTTTCACCAGATAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-1141s21c1
Sequence:CCGGAGTCCTAACTGTTAGGGTAAACTCGAGTTTACCCTAACAGTTAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-438s21c1
Sequence:CCGGGGGTCTGCAAACATGACAAAGCTCGAGCTTTGTCATGTTTGCAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-981s21c1
Sequence:CCGGGGAGTTGTAGATGGCCTAATACTCGAGTATTAGGCCATCTACAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019003
SPIN2A MISSION shRNA shRNA Plasmid DNA
spindlin family, member 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019003.2-1170s1c1
Sequence:CCGGCATGTGTGGAAACAAATGTATCTCGAGATACATTTGTTTCCACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-744s1c1
Sequence:CCGGGCAAATACCATAATTGGCAAACTCGAGTTTGCCAATTATGGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-837s1c1
Sequence:CCGGCCTATCATGAAAGCCTGGTTTCTCGAGAAACCAGGCTTTCATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-723s1c1
Sequence:CCGGCACATTAGTGATGCCAACCTTCTCGAGAAGGTTGGCATCACTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-609s1c1
Sequence:CCGGCCCTCTCTTTATCTGGTGAAACTCGAGTTTCACCAGATAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-1141s21c1
Sequence:CCGGAGTCCTAACTGTTAGGGTAAACTCGAGTTTACCCTAACAGTTAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-438s21c1
Sequence:CCGGGGGTCTGCAAACATGACAAAGCTCGAGCTTTGTCATGTTTGCAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-981s21c1
Sequence:CCGGGGAGTTGTAGATGGCCTAATACTCGAGTATTAGGCCATCTACAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019003
SPIN2A MISSION shRNA Lentiviral Transduction Particles
spindlin family, member 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019003.2-1170s1c1
Sequence:CCGGCATGTGTGGAAACAAATGTATCTCGAGATACATTTGTTTCCACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-744s1c1
Sequence:CCGGGCAAATACCATAATTGGCAAACTCGAGTTTGCCAATTATGGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-837s1c1
Sequence:CCGGCCTATCATGAAAGCCTGGTTTCTCGAGAAACCAGGCTTTCATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-723s1c1
Sequence:CCGGCACATTAGTGATGCCAACCTTCTCGAGAAGGTTGGCATCACTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019003.2-609s1c1
Sequence:CCGGCCCTCTCTTTATCTGGTGAAACTCGAGTTTCACCAGATAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-1141s21c1
Sequence:CCGGAGTCCTAACTGTTAGGGTAAACTCGAGTTTACCCTAACAGTTAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-438s21c1
Sequence:CCGGGGGTCTGCAAACATGACAAAGCTCGAGCTTTGTCATGTTTGCAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019003.3-981s21c1
Sequence:CCGGGGAGTTGTAGATGGCCTAATACTCGAGTATTAGGCCATCTACAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks