EMAIL THIS PAGE TO A FRIEND

SPIN2B

spindlin family, member 2B

Synonyms: SPIN-2 SPIN-2B SPIN2_duplicate dJ323P24.2
Species: Human SPIN2B(474343), domestic guinea pig Spin2b(100721650), naked mole-rat Spin2b(101707021), cow SPIN2B(524601)
UniProtKB ID: Q9BPZ2, Q7Z2M0
Gene ID:
domestic guinea pig(100721650) spindlin family, member 2B
naked mole-rat(101707021) spindlin family, member 2B
cow(524601) spindlin family, member 2B
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006683 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006681 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016747 predicted 868
2 SASI_Hs01_00016748 predicted 669
3 SASI_Hs01_00016749 predicted 582
4 SASI_Hs01_00016750 predicted 914
5 SASI_Hs02_00305133 predicted 656
6 SASI_Hs01_00016751 predicted 525
7 SASI_Hs01_00016752 predicted 823
8 SASI_Hs01_00016753 predicted 1009
9 SASI_Hs01_00016754 predicted 669
10 SASI_Hs01_00016755 predicted 549
11 SASI_Hs01_00016746 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006683
SPIN2B MISSION shRNA Bacterial Glycerol Stock
spindlin family, member 2B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-321s1c1
Sequence:CCGGCTGGGTCTGCAAACATGACAACTCGAGTTGTCATGTTTGCAGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1055s1c1
Sequence:CCGGCATGTGTGGAAACAAATGTATCTCGAGATACATTTGTTTCCACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1053s1c1
Sequence:CCGGCACATGTGTGGAAACAAATGTCTCGAGACATTTGTTTCCACACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-599s1c1
Sequence:CCGGGCATCATCTCACATTAGTGATCTCGAGATCACTAATGTGAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-408s1c1
Sequence:CCGGGCTGCAGAATTTCTCATGGATCTCGAGATCCATGAGAAATTCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1052s1c1
Sequence:CCGGGCACATGTGTGGAAACAAATGCTCGAGCATTTGTTTCCACACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006683
SPIN2B MISSION shRNA shRNA Plasmid DNA
spindlin family, member 2B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-321s1c1
Sequence:CCGGCTGGGTCTGCAAACATGACAACTCGAGTTGTCATGTTTGCAGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1055s1c1
Sequence:CCGGCATGTGTGGAAACAAATGTATCTCGAGATACATTTGTTTCCACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1053s1c1
Sequence:CCGGCACATGTGTGGAAACAAATGTCTCGAGACATTTGTTTCCACACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-599s1c1
Sequence:CCGGGCATCATCTCACATTAGTGATCTCGAGATCACTAATGTGAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-408s1c1
Sequence:CCGGGCTGCAGAATTTCTCATGGATCTCGAGATCCATGAGAAATTCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1052s1c1
Sequence:CCGGGCACATGTGTGGAAACAAATGCTCGAGCATTTGTTTCCACACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006683
SPIN2B MISSION shRNA Lentiviral Transduction Particles
spindlin family, member 2B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-321s1c1
Sequence:CCGGCTGGGTCTGCAAACATGACAACTCGAGTTGTCATGTTTGCAGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1055s1c1
Sequence:CCGGCATGTGTGGAAACAAATGTATCTCGAGATACATTTGTTTCCACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1053s1c1
Sequence:CCGGCACATGTGTGGAAACAAATGTCTCGAGACATTTGTTTCCACACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-599s1c1
Sequence:CCGGGCATCATCTCACATTAGTGATCTCGAGATCACTAATGTGAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006683.1-408s1c1
Sequence:CCGGGCTGCAGAATTTCTCATGGATCTCGAGATCCATGAGAAATTCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006683.1-1052s1c1
Sequence:CCGGGCACATGTGTGGAAACAAATGCTCGAGCATTTGTTTCCACACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks