EMAIL THIS PAGE TO A FRIEND

SPIN3

spindlin family, member 3

Synonyms: SPIN-3 bA445O16.1
UniProtKB ID: Q5JUX0, B2RUW3, B7Z8W2, Q8N5D9
Gene ID:
Mouse(675593) spindlin family, member 3
cow(783775) spindlin family, member 3
216 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000727 Anti-SPIN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010862 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152381 MISSION® esiRNA esiRNA human SPIN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010862 Rosetta Predictions human pricing
XR_004805 Rosetta Predictions mouse pricing
XR_031023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305802 predicted 1112
2 SASI_Hs02_00305803 predicted 608
3 SASI_Hs02_00305804 predicted 1153
4 SASI_Hs02_00305805 predicted 652
5 SASI_Hs02_00305806 predicted 707
6 SASI_Hs01_00116252 predicted 498
7 SASI_Hs02_00305807 predicted 569
8 SASI_Hs02_00305808 predicted 896
9 SASI_Hs02_00305809 predicted 674
10 SASI_Hs01_00116258 predicted 527
11 SASI_Hs01_00116250 predicted 1026
12 SASI_Hs01_00116251 predicted 723
13 SASI_Hs01_00116253 predicted 831
14 SASI_Hs01_00116254 predicted 825
15 SASI_Hs01_00116255 predicted 801
16 SASI_Hs01_00116256 predicted 773
17 SASI_Hs01_00116257 predicted 749
18 SASI_Hs01_00116259 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_004805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00453278 predicted 456
2 SASI_Mm01_00241618 predicted 232
3 SASI_Mm02_00453279 predicted 726
4 SASI_Mm01_00241620 predicted 237
5 SASI_Mm01_00241621 predicted 260
6 SASI_Mm02_00453280 predicted 150
7 SASI_Mm02_00453281 predicted 993
8 SASI_Mm01_00241616 predicted 361
9 SASI_Mm01_00241617 predicted 362
10 SASI_Mm01_00241619 predicted 355
11 SASI_Mm01_00241622 predicted 273
12 SASI_Mm01_00241623 predicted 234
13 SASI_Mm01_00241624 predicted 243
14 SASI_Mm01_00241625 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_031023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00456777 predicted 464
2 SASI_Mm02_00456778 predicted 233
3 SASI_Mm02_00456779 predicted 726
4 SASI_Mm02_00456780 predicted 234
5 SASI_Mm02_00456781 predicted 260
6 SASI_Mm02_00456782 predicted 149
7 SASI_Mm02_00456783 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010862
SPIN3 MISSION shRNA Bacterial Glycerol Stock
spindlin family, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010862.1-1429s1c1
Sequence:CCGGCCTAACTGAAGTTGCCCTCTTCTCGAGAAGAGGGCAACTTCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-478s1c1
Sequence:CCGGGAGATGAACCTCTAACACAGTCTCGAGACTGTGTTAGAGGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-910s1c1
Sequence:CCGGCCATATTTGCTAGATGCTTTACTCGAGTAAAGCATCTAGCAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-483s1c1
Sequence:CCGGGAACCTCTAACACAGTGGAAACTCGAGTTTCCACTGTGTTAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-464s1c1
Sequence:CCGGCGGATGGAAAGATGGAGATGACTCGAGTCATCTCCATCTTTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-474s1c1
Sequence:CCGGGATGGAGATGAACCTCTAACACTCGAGTGTTAGAGGTTCATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-358s1c1
Sequence:CCGGGCAGTGTGTCTGTTACCATGACTCGAGTCATGGTAACAGACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-377s1c1
Sequence:CCGGGATAAAGAGGAAGGCTGCACACTCGAGTGTGCAGCCTTCCTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010862.2-1138s21c1
Sequence:CCGGCCAAATATATGAGACTCTAAACTCGAGTTTAGAGTCTCATATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010862
SPIN3 MISSION shRNA shRNA Plasmid DNA
spindlin family, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010862.1-1429s1c1
Sequence:CCGGCCTAACTGAAGTTGCCCTCTTCTCGAGAAGAGGGCAACTTCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-478s1c1
Sequence:CCGGGAGATGAACCTCTAACACAGTCTCGAGACTGTGTTAGAGGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-910s1c1
Sequence:CCGGCCATATTTGCTAGATGCTTTACTCGAGTAAAGCATCTAGCAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-483s1c1
Sequence:CCGGGAACCTCTAACACAGTGGAAACTCGAGTTTCCACTGTGTTAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-464s1c1
Sequence:CCGGCGGATGGAAAGATGGAGATGACTCGAGTCATCTCCATCTTTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-474s1c1
Sequence:CCGGGATGGAGATGAACCTCTAACACTCGAGTGTTAGAGGTTCATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-358s1c1
Sequence:CCGGGCAGTGTGTCTGTTACCATGACTCGAGTCATGGTAACAGACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-377s1c1
Sequence:CCGGGATAAAGAGGAAGGCTGCACACTCGAGTGTGCAGCCTTCCTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010862.2-1138s21c1
Sequence:CCGGCCAAATATATGAGACTCTAAACTCGAGTTTAGAGTCTCATATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010862
SPIN3 MISSION shRNA Lentiviral Transduction Particles
spindlin family, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010862.1-1429s1c1
Sequence:CCGGCCTAACTGAAGTTGCCCTCTTCTCGAGAAGAGGGCAACTTCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-478s1c1
Sequence:CCGGGAGATGAACCTCTAACACAGTCTCGAGACTGTGTTAGAGGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-910s1c1
Sequence:CCGGCCATATTTGCTAGATGCTTTACTCGAGTAAAGCATCTAGCAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-483s1c1
Sequence:CCGGGAACCTCTAACACAGTGGAAACTCGAGTTTCCACTGTGTTAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-464s1c1
Sequence:CCGGCGGATGGAAAGATGGAGATGACTCGAGTCATCTCCATCTTTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-474s1c1
Sequence:CCGGGATGGAGATGAACCTCTAACACTCGAGTGTTAGAGGTTCATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-358s1c1
Sequence:CCGGGCAGTGTGTCTGTTACCATGACTCGAGTCATGGTAACAGACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010862.1-377s1c1
Sequence:CCGGGATAAAGAGGAAGGCTGCACACTCGAGTGTGCAGCCTTCCTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010862.2-1138s21c1
Sequence:CCGGCCAAATATATGAGACTCTAAACTCGAGTTTAGAGTCTCATATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks