EMAIL THIS PAGE TO A FRIEND

SPIN4

spindlin family, member 4

UniProtKB ID: Q56A73, Q5JUL2
Gene ID:
Mouse(270624) spindlin family, member 4
Rat(299038) spindlin family, member 4
dog(480938) spindlin family, member 4
domestic cat(101098609) spindlin family, member 4
cow(540146) spindlin family, member 4
sheep(101109772) spindlin family, member 4
domestic guinea pig(100732166) spindlin family, member 4
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012968 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012968 Rosetta Predictions human pricing
XM_001066641 Rosetta Predictions rat pricing
XM_234144 Rosetta Predictions rat pricing
NM_178753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232587 predicted 1362
2 SASI_Hs01_00232588 predicted 1370
3 SASI_Hs01_00232589 predicted 1039
4 SASI_Hs01_00232591 predicted 1260
5 SASI_Hs01_00232593 predicted 1294
6 SASI_Hs01_00232594 predicted 1049
7 SASI_Hs01_00232595 predicted 1301
8 SASI_Hs01_00232596 predicted 955
9 SASI_Hs02_00306267 predicted 708
10 SASI_Hs02_00306268 predicted 769
11 SASI_Hs01_00232590 predicted 1217
12 SASI_Hs01_00232592 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318257 predicted 610
2 SASI_Rn02_00318258 predicted 518
3 SASI_Rn02_00318259 predicted 924
4 SASI_Rn02_00318260 predicted 566
5 SASI_Rn02_00318261 predicted 689
6 SASI_Rn02_00318262 predicted 741
7 SASI_Rn02_00318263 predicted 731
8 SASI_Rn02_00318264 predicted 615
9 SASI_Rn02_00318265 predicted 598
10 SASI_Rn02_00318266 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388324 predicted 616
2 SASI_Rn02_00388325 predicted 516
3 SASI_Rn02_00388326 predicted 919
4 SASI_Rn02_00388327 predicted 570
5 SASI_Rn02_00388328 predicted 689
6 SASI_Rn02_00388329 predicted 737
7 SASI_Rn02_00388330 predicted 729
8 SASI_Rn02_00388331 predicted 609
9 SASI_Rn02_00388332 predicted 594
10 SASI_Rn02_00388333 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151971 predicted 615
2 SASI_Mm01_00151972 predicted 1226
3 SASI_Mm01_00151973 predicted 1118
4 SASI_Mm01_00151974 predicted 703
5 SASI_Mm01_00151975 predicted 920
6 SASI_Mm01_00151976 predicted 1387
7 SASI_Mm01_00151977 predicted 1191
8 SASI_Mm01_00151978 predicted 1263
9 SASI_Mm01_00151979 predicted 1267
10 SASI_Mm01_00151980 predicted 854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178753
VALIDATED
SPIN4 MISSION shRNA Bacterial Glycerol Stock
spindlin family, member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178753.4-1127s21c1
Sequence:CCGGCAAGAGAACTGGGATCTTTATCTCGAGATAAAGATCCCAGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1165s21c1
Sequence:CCGGAGCCATCTGTCTACTTCATTACTCGAGTAATGAAGTAGACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178753.4-698s21c1
Sequence:CCGGGCCCACTCTGTATATCATCAACTCGAGTTGATGATATACAGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1267s21c1
Sequence:CCGGGAACTATCAGAGGATAAATATCTCGAGATATTTATCCTCTGATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1006s21c1
Sequence:CCGGATGGTGACCTGCGTATCATTCCTCGAGGAATGATACGCAGGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178753.2-1960s1c1
Sequence:CCGGCCTGACTCAATGAGACTTATTCTCGAGAATAAGTCTCATTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-619s1c1
Sequence:CCGGCGCATTCAACACGGCTGGAAACTCGAGTTTCCAGCCGTGTTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-700s1c1
Sequence:CCGGCCCACTCTGTATATCATCAAACTCGAGTTTGATGATATACAGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178753.2-699s1c1
Sequence:CCGGGCCCACTCTGTATATCATCAACTCGAGTTGATGATATACAGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-1127s1c1
Sequence:CCGGCCAAGAGAACTGGGATCTTTACTCGAGTAAAGATCCCAGTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178753
VALIDATED
SPIN4 MISSION shRNA shRNA Plasmid DNA
spindlin family, member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178753.4-1127s21c1
Sequence:CCGGCAAGAGAACTGGGATCTTTATCTCGAGATAAAGATCCCAGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1165s21c1
Sequence:CCGGAGCCATCTGTCTACTTCATTACTCGAGTAATGAAGTAGACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178753.4-698s21c1
Sequence:CCGGGCCCACTCTGTATATCATCAACTCGAGTTGATGATATACAGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1267s21c1
Sequence:CCGGGAACTATCAGAGGATAAATATCTCGAGATATTTATCCTCTGATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1006s21c1
Sequence:CCGGATGGTGACCTGCGTATCATTCCTCGAGGAATGATACGCAGGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178753.2-1960s1c1
Sequence:CCGGCCTGACTCAATGAGACTTATTCTCGAGAATAAGTCTCATTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-619s1c1
Sequence:CCGGCGCATTCAACACGGCTGGAAACTCGAGTTTCCAGCCGTGTTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-700s1c1
Sequence:CCGGCCCACTCTGTATATCATCAAACTCGAGTTTGATGATATACAGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178753.2-699s1c1
Sequence:CCGGGCCCACTCTGTATATCATCAACTCGAGTTGATGATATACAGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-1127s1c1
Sequence:CCGGCCAAGAGAACTGGGATCTTTACTCGAGTAAAGATCCCAGTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178753
VALIDATED
SPIN4 MISSION shRNA Lentiviral Transduction Particles
spindlin family, member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178753.4-1127s21c1
Sequence:CCGGCAAGAGAACTGGGATCTTTATCTCGAGATAAAGATCCCAGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1165s21c1
Sequence:CCGGAGCCATCTGTCTACTTCATTACTCGAGTAATGAAGTAGACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178753.4-698s21c1
Sequence:CCGGGCCCACTCTGTATATCATCAACTCGAGTTGATGATATACAGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1267s21c1
Sequence:CCGGGAACTATCAGAGGATAAATATCTCGAGATATTTATCCTCTGATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178753.4-1006s21c1
Sequence:CCGGATGGTGACCTGCGTATCATTCCTCGAGGAATGATACGCAGGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178753.2-1960s1c1
Sequence:CCGGCCTGACTCAATGAGACTTATTCTCGAGAATAAGTCTCATTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-619s1c1
Sequence:CCGGCGCATTCAACACGGCTGGAAACTCGAGTTTCCAGCCGTGTTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-700s1c1
Sequence:CCGGCCCACTCTGTATATCATCAAACTCGAGTTTGATGATATACAGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178753.2-699s1c1
Sequence:CCGGGCCCACTCTGTATATCATCAACTCGAGTTGATGATATACAGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178753.2-1127s1c1
Sequence:CCGGCCAAGAGAACTGGGATCTTTACTCGAGTAAAGATCCCAGTTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012968
VALIDATED
SPIN4 MISSION shRNA Bacterial Glycerol Stock
spindlin family, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-609s1c1
Sequence:CCGGCACTTTCCTCACTCGTAGGAACTCGAGTTCCTACGAGTGAGGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-2443s1c1
Sequence:CCGGCCCACCCAAAGTCATACAAATCTCGAGATTTGTATGACTTTGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-1187s1c1
Sequence:CCGGCGAAGCCATCTGTTTACTTCACTCGAGTGAAGTAAACAGATGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-981s1c1
Sequence:CCGGCGAGAAAGATCCTGTTCTCTACTCGAGTAGAGAACAGGATCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-717s1c1
Sequence:CCGGCGTGAAGCCCACTCTTTACATCTCGAGATGTAAAGAGTGGGCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012968
VALIDATED
SPIN4 MISSION shRNA shRNA Plasmid DNA
spindlin family, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-609s1c1
Sequence:CCGGCACTTTCCTCACTCGTAGGAACTCGAGTTCCTACGAGTGAGGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-2443s1c1
Sequence:CCGGCCCACCCAAAGTCATACAAATCTCGAGATTTGTATGACTTTGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-1187s1c1
Sequence:CCGGCGAAGCCATCTGTTTACTTCACTCGAGTGAAGTAAACAGATGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-981s1c1
Sequence:CCGGCGAGAAAGATCCTGTTCTCTACTCGAGTAGAGAACAGGATCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-717s1c1
Sequence:CCGGCGTGAAGCCCACTCTTTACATCTCGAGATGTAAAGAGTGGGCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012968
VALIDATED
SPIN4 MISSION shRNA Lentiviral Transduction Particles
spindlin family, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-609s1c1
Sequence:CCGGCACTTTCCTCACTCGTAGGAACTCGAGTTCCTACGAGTGAGGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-2443s1c1
Sequence:CCGGCCCACCCAAAGTCATACAAATCTCGAGATTTGTATGACTTTGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-1187s1c1
Sequence:CCGGCGAAGCCATCTGTTTACTTCACTCGAGTGAAGTAAACAGATGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-981s1c1
Sequence:CCGGCGAGAAAGATCCTGTTCTCTACTCGAGTAGAGAACAGGATCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001012968.1-717s1c1
Sequence:CCGGCGTGAAGCCCACTCTTTACATCTCGAGATGTAAAGAGTGGGCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks