EMAIL THIS PAGE TO A FRIEND

SPINK13

serine peptidase inhibitor, Kazal type 13 (putative)

Synonyms: HBVDNAPTP1 HESPINTOR LiESP6 SPINK5L3
UniProtKB ID: Q1W4C9, A1A4Y2
Gene ID:
Mouse(100038417) serine peptidase inhibitor, Kazal type 13
Rat(689570) serine peptidase inhibitor, Kazal type 13 (putative)
domestic guinea pig(101788259) serine peptidase inhibitor, Kazal type 13 (putative)
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036456 Anti-SPINK13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040129 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216431 MISSION® esiRNA esiRNA targeting mouse Spink13 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040129 Rosetta Predictions human pricing
NM_001109539 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308842 predicted 229
2 SASI_Hs02_00308843 predicted 230
3 SASI_Hs01_00092834 predicted 254
4 SASI_Hs01_00092835 predicted 229
5 SASI_Hs02_00308844 predicted 280
6 SASI_Hs01_00092836 predicted 237
7 SASI_Hs02_00308845 predicted 245
8 SASI_Hs02_00308846 predicted 232
9 SASI_Hs02_00308847 predicted 229
10 SASI_Hs02_00308848 predicted 355
11 SASI_Hs01_00092827 predicted 135
12 SASI_Hs01_00092828 predicted 234
13 SASI_Hs01_00092829 predicted 38
14 SASI_Hs01_00092830 predicted 59
15 SASI_Hs01_00092831 predicted 125
16 SASI_Hs01_00092832 predicted 236
17 SASI_Hs01_00092833 predicted 132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249399 predicted 344
2 SASI_Rn02_00249400 predicted 368
3 SASI_Rn02_00249401 predicted 424
4 SASI_Rn02_00249402 predicted 251
5 SASI_Rn02_00249403 predicted 333
6 SASI_Rn02_00249404 predicted 250
7 SASI_Rn02_00249405 predicted 223
8 SASI_Rn02_00249406 predicted 341
9 SASI_Rn02_00249407 predicted 310
10 SASI_Rn02_00249408 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040129
SPINK13 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 13 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-93s21c1
Sequence:CCGGTTCCTGGTATGCTCTACTTTGCTCGAGCAAAGTAGAGCATACCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-193s21c1
Sequence:CCGGCACTGGACCCTGATTACAATGCTCGAGCATTGTAATCAGGGTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-234s21c1
Sequence:CCGGGCACCTGTTTGTGCCTCAAATCTCGAGATTTGAGGCACAAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-298s21c1
Sequence:CCGGGGGAATTTCATTATCGTATAACTCGAGTTATACGATAATGAAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-261s21c1
Sequence:CCGGACTTTCCAGAATGAGTGTTTCCTCGAGGAAACACTCATTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040129
SPINK13 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 13 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-93s21c1
Sequence:CCGGTTCCTGGTATGCTCTACTTTGCTCGAGCAAAGTAGAGCATACCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-193s21c1
Sequence:CCGGCACTGGACCCTGATTACAATGCTCGAGCATTGTAATCAGGGTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-234s21c1
Sequence:CCGGGCACCTGTTTGTGCCTCAAATCTCGAGATTTGAGGCACAAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-298s21c1
Sequence:CCGGGGGAATTTCATTATCGTATAACTCGAGTTATACGATAATGAAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-261s21c1
Sequence:CCGGACTTTCCAGAATGAGTGTTTCCTCGAGGAAACACTCATTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040129
SPINK13 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 13 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-93s21c1
Sequence:CCGGTTCCTGGTATGCTCTACTTTGCTCGAGCAAAGTAGAGCATACCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-193s21c1
Sequence:CCGGCACTGGACCCTGATTACAATGCTCGAGCATTGTAATCAGGGTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-234s21c1
Sequence:CCGGGCACCTGTTTGTGCCTCAAATCTCGAGATTTGAGGCACAAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-298s21c1
Sequence:CCGGGGGAATTTCATTATCGTATAACTCGAGTTATACGATAATGAAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040129.2-261s21c1
Sequence:CCGGACTTTCCAGAATGAGTGTTTCCTCGAGGAAACACTCATTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks