EMAIL THIS PAGE TO A FRIEND

SPINK14

serine peptidase inhibitor, Kazal type 14 (putative)

Synonyms: SPINK5L2
UniProtKB ID: Q6IE38
Gene ID:
Mouse(433178) serine peptidase inhibitor, Kazal type 14
Rat(408231) serine peptidase inhibitor, Kazal type 14
dog(100685265) serine peptidase inhibitor, Kazal type 14 (putative)
domestic guinea pig(100721832) serine peptidase inhibitor, Kazal type 14 (putative)
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301857 ANTI-SPINK5L2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001325 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001325 Rosetta Predictions human pricing
NM_001008875 Rosetta Predictions rat pricing
NM_001039218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303718 predicted 111
2 SASI_Hs01_00034309 predicted 108
3 SASI_Hs01_00034310 predicted 50
4 SASI_Hs01_00034311 predicted 92
5 SASI_Hs01_00034312 predicted 141
6 SASI_Hs01_00034313 predicted 207
7 SASI_Hs01_00034315 predicted 128
8 SASI_Hs01_00034316 predicted 93
9 SASI_Hs01_00034317 predicted 175
10 SASI_Hs01_00034318 predicted 227
11 SASI_Hs01_00034314 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106507 predicted 262
2 SASI_Rn01_00106509 predicted 90
3 SASI_Rn01_00106510 predicted 89
4 SASI_Rn01_00106512 predicted 71
5 SASI_Rn01_00106513 predicted 86
6 SASI_Rn01_00106514 predicted 86
7 SASI_Rn01_00106515 predicted 165
8 SASI_Rn02_00199407 predicted 75
9 SASI_Rn01_00106516 predicted 257
10 SASI_Rn02_00199408 predicted 232
11 SASI_Rn01_00106508 predicted 230
12 SASI_Rn01_00106511 predicted 191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289961 predicted 299
2 SASI_Mm02_00289962 predicted 311
3 SASI_Mm02_00289963 predicted 343
4 SASI_Mm02_00289964 predicted 341
5 SASI_Mm02_00289965 predicted 299
6 SASI_Mm02_00289966 predicted 338
7 SASI_Mm02_00289967 predicted 297
8 SASI_Mm02_00289968 predicted 297
9 SASI_Mm02_00289969 predicted 318
10 SASI_Mm02_00289970 predicted 516
11 SASI_Mm01_00056415 predicted 1129
12 SASI_Mm01_00056416 predicted 1318
13 SASI_Mm01_00056417 predicted 912
14 SASI_Mm01_00056418 predicted 1233
15 SASI_Mm01_00056419 predicted 1284
16 SASI_Mm01_00056420 predicted 1327
17 SASI_Mm01_00056421 predicted 1039
18 SASI_Mm01_00056422 predicted 1254
19 SASI_Mm01_00056423 predicted 1382
20 SASI_Mm01_00056424 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001325
SPINK14 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 14 (putative)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-234s21c1
Sequence:CCGGGTGTGTTGAGAGCTTGAAATCCTCGAGGATTTCAAGCTCTCAACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-173s21c1
Sequence:CCGGCTGGCTTATATCAACCCATCTCTCGAGAGATGGGTTGATATAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-212s21c1
Sequence:CCGGCCTATGATAATCCCTGCATTCCTCGAGGAATGCAGGGATTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-97s1c1
Sequence:CCGGCGTGGAATTATTAAGGTGAAACTCGAGTTTCACCTTAATAATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-90s1c1
Sequence:CCGGGCCACCACGTGGAATTATTAACTCGAGTTAATAATTCCACGTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-119s1c1
Sequence:CCGGGTCCATATGAGAAAGTAAACTCTCGAGAGTTTACTTTCTCATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-144s1c1
Sequence:CCGGCTGGTACAATGGAACGGTCAACTCGAGTTGACCGTTCCATTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-49s1c1
Sequence:CCGGCATTTGGTGTTATCTTCTGTTCTCGAGAACAGAAGATAACACCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001325
SPINK14 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 14 (putative)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-234s21c1
Sequence:CCGGGTGTGTTGAGAGCTTGAAATCCTCGAGGATTTCAAGCTCTCAACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-173s21c1
Sequence:CCGGCTGGCTTATATCAACCCATCTCTCGAGAGATGGGTTGATATAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-212s21c1
Sequence:CCGGCCTATGATAATCCCTGCATTCCTCGAGGAATGCAGGGATTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-97s1c1
Sequence:CCGGCGTGGAATTATTAAGGTGAAACTCGAGTTTCACCTTAATAATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-90s1c1
Sequence:CCGGGCCACCACGTGGAATTATTAACTCGAGTTAATAATTCCACGTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-119s1c1
Sequence:CCGGGTCCATATGAGAAAGTAAACTCTCGAGAGTTTACTTTCTCATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-144s1c1
Sequence:CCGGCTGGTACAATGGAACGGTCAACTCGAGTTGACCGTTCCATTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-49s1c1
Sequence:CCGGCATTTGGTGTTATCTTCTGTTCTCGAGAACAGAAGATAACACCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001325
SPINK14 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 14 (putative)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-234s21c1
Sequence:CCGGGTGTGTTGAGAGCTTGAAATCCTCGAGGATTTCAAGCTCTCAACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-173s21c1
Sequence:CCGGCTGGCTTATATCAACCCATCTCTCGAGAGATGGGTTGATATAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001325.1-212s21c1
Sequence:CCGGCCTATGATAATCCCTGCATTCCTCGAGGAATGCAGGGATTATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-97s1c1
Sequence:CCGGCGTGGAATTATTAAGGTGAAACTCGAGTTTCACCTTAATAATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-90s1c1
Sequence:CCGGGCCACCACGTGGAATTATTAACTCGAGTTAATAATTCCACGTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-119s1c1
Sequence:CCGGGTCCATATGAGAAAGTAAACTCTCGAGAGTTTACTTTCTCATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-144s1c1
Sequence:CCGGCTGGTACAATGGAACGGTCAACTCGAGTTGACCGTTCCATTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001325.1-49s1c1
Sequence:CCGGCATTTGGTGTTATCTTCTGTTCTCGAGAACAGAAGATAACACCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484723
SPINK14 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 14 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484723.2-383s1c1
Sequence:CCGGTCCTGGTAACAAAGACCTGTTCTCGAGAACAGGTCTTTGTTACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-299s1c1
Sequence:CCGGCTATGATAATCCCTGCATCTTCTCGAGAAGATGCAGGGATTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-310s1c1
Sequence:CCGGCCTGCATCTTGTGTGTTGAGACTCGAGTCTCAACACACAAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-119s1c1
Sequence:CCGGGTTCTCCATTATGCTCCACTTCTCGAGAAGTGGAGCATAATGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-176s1c1
Sequence:CCGGGCCTACACATGGACTTATTAACTCGAGTTAATAAGTCCATGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484723
SPINK14 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 14 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484723.2-383s1c1
Sequence:CCGGTCCTGGTAACAAAGACCTGTTCTCGAGAACAGGTCTTTGTTACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-299s1c1
Sequence:CCGGCTATGATAATCCCTGCATCTTCTCGAGAAGATGCAGGGATTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-310s1c1
Sequence:CCGGCCTGCATCTTGTGTGTTGAGACTCGAGTCTCAACACACAAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-119s1c1
Sequence:CCGGGTTCTCCATTATGCTCCACTTCTCGAGAAGTGGAGCATAATGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-176s1c1
Sequence:CCGGGCCTACACATGGACTTATTAACTCGAGTTAATAAGTCCATGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484723
SPINK14 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 14 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484723.2-383s1c1
Sequence:CCGGTCCTGGTAACAAAGACCTGTTCTCGAGAACAGGTCTTTGTTACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-299s1c1
Sequence:CCGGCTATGATAATCCCTGCATCTTCTCGAGAAGATGCAGGGATTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-310s1c1
Sequence:CCGGCCTGCATCTTGTGTGTTGAGACTCGAGTCTCAACACACAAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-119s1c1
Sequence:CCGGGTTCTCCATTATGCTCCACTTCTCGAGAAGTGGAGCATAATGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484723.2-176s1c1
Sequence:CCGGGCCTACACATGGACTTATTAACTCGAGTTAATAAGTCCATGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks