EMAIL THIS PAGE TO A FRIEND

SPINK1

serine peptidase inhibitor, Kazal type 1

Synonyms: PCTT PSTI Spink3 TATI TCP
UniProtKB ID: P00995
Gene ID:
Human(6690) Summary: The protein encoded by this gene is a trypsin inhibitor, which is secreted from pancreatic acinar cells into pancreatic juice. It is thought to function in the prevention of trypsin-catalyzed premature activation of zymogens within the pancreas and the pancreatic duct. Mutations in this gene are associated with hereditary pancreatitis and tropical calcific pancreatitis. [provided by RefSeq, Oct 2008]
Rat(266602) serine peptidase inhibitor, Kazal type 1
domestic cat(101085948) serine peptidase inhibitor, Kazal type 1
dog(608433) serine peptidase inhibitor, Kazal type 1
naked mole-rat(101704124) serine peptidase inhibitor, Kazal type 1
domestic guinea pig(100719912) serine peptidase inhibitor, Kazal type 1
cow(574092) serine peptidase inhibitor, Kazal type 1
sheep(101115618) serine peptidase inhibitor, Kazal type 1
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1717 Human SPINK1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003122 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056911 MISSION® esiRNA esiRNA human SPINK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003122 Rosetta Predictions human pricing
NM_152936 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023181 predicted 207
2 SASI_Hs01_00023182 predicted 199
3 SASI_Hs01_00023183 predicted 204
4 SASI_Hs01_00023184 predicted 198
5 SASI_Hs01_00023185 predicted 393
6 SASI_Hs01_00023186 predicted 198
7 SASI_Hs01_00023187 predicted 278
8 SASI_Hs01_00023188 predicted 156
9 SASI_Hs02_00335106 predicted 186
10 SASI_Hs01_00023189 predicted 398
11 SASI_Hs01_00023190 predicted 166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108106 predicted 109
2 SASI_Rn01_00108107 predicted 147
3 SASI_Rn01_00108108 predicted 292
4 SASI_Rn01_00108109 predicted 284
5 SASI_Rn01_00108110 predicted 183
6 SASI_Rn01_00108111 predicted 226
7 SASI_Rn01_00108112 predicted 155
8 SASI_Rn01_00108113 predicted 271
9 SASI_Rn02_00268923 predicted 140
10 SASI_Rn02_00268924 predicted 112
11 SASI_Rn01_00108104 predicted 289
12 SASI_Rn01_00108105 predicted 111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003122
SPINK1 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-208s1c1
Sequence:CCGGGCCAAATGTTACAATGAACTTCTCGAGAAGTTCATTGTAACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-267s1c1
Sequence:CCGGTGATGGAAATACTTATCCCAACTCGAGTTGGGATAAGTATTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-284s1c1
Sequence:CCGGCCAATGAATGCGTGTTATGTTCTCGAGAACATAACACGCATTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-158s1c1
Sequence:CCGGCCCTGTTGAGTCTATCTGGTACTCGAGTACCAGATAGACTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-260s1c1
Sequence:CCGGGTGGGACTGATGGAAATACTTCTCGAGAAGTATTTCCATCAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-240s21c1
Sequence:CCGGCAAGATATATGACCCTGTCTGCTCGAGCAGACAGGGTCATATATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-196s21c1
Sequence:CCGGCTGGGAAGAGAGGCCAAATGTCTCGAGACATTTGGCCTCTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-228s21c1
Sequence:CCGGTAATGGATGCACCAAGATATACTCGAGTATATCTTGGTGCATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003122
SPINK1 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-208s1c1
Sequence:CCGGGCCAAATGTTACAATGAACTTCTCGAGAAGTTCATTGTAACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-267s1c1
Sequence:CCGGTGATGGAAATACTTATCCCAACTCGAGTTGGGATAAGTATTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-284s1c1
Sequence:CCGGCCAATGAATGCGTGTTATGTTCTCGAGAACATAACACGCATTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-158s1c1
Sequence:CCGGCCCTGTTGAGTCTATCTGGTACTCGAGTACCAGATAGACTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-260s1c1
Sequence:CCGGGTGGGACTGATGGAAATACTTCTCGAGAAGTATTTCCATCAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-240s21c1
Sequence:CCGGCAAGATATATGACCCTGTCTGCTCGAGCAGACAGGGTCATATATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-196s21c1
Sequence:CCGGCTGGGAAGAGAGGCCAAATGTCTCGAGACATTTGGCCTCTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-228s21c1
Sequence:CCGGTAATGGATGCACCAAGATATACTCGAGTATATCTTGGTGCATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003122
SPINK1 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-208s1c1
Sequence:CCGGGCCAAATGTTACAATGAACTTCTCGAGAAGTTCATTGTAACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-267s1c1
Sequence:CCGGTGATGGAAATACTTATCCCAACTCGAGTTGGGATAAGTATTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-284s1c1
Sequence:CCGGCCAATGAATGCGTGTTATGTTCTCGAGAACATAACACGCATTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-158s1c1
Sequence:CCGGCCCTGTTGAGTCTATCTGGTACTCGAGTACCAGATAGACTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003122.2-260s1c1
Sequence:CCGGGTGGGACTGATGGAAATACTTCTCGAGAAGTATTTCCATCAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-240s21c1
Sequence:CCGGCAAGATATATGACCCTGTCTGCTCGAGCAGACAGGGTCATATATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-196s21c1
Sequence:CCGGCTGGGAAGAGAGGCCAAATGTCTCGAGACATTTGGCCTCTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003122.3-228s21c1
Sequence:CCGGTAATGGATGCACCAAGATATACTCGAGTATATCTTGGTGCATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks