EMAIL THIS PAGE TO A FRIEND

SPINK2

serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)

Synonyms: HUSI-II
UniProtKB ID: P20155, Q6FGH2
Gene ID:
Human(6691) Summary: This gene encodes a member of the family of serine protease inhibitors of the Kazal type (SPINK). The encoded protein acts as a trypsin and acrosin inhibitor in the genital tract and is localized in the spermatozoa. The protein has been associated with the progression of lymphomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(69982) serine peptidase inhibitor, Kazal type 2
Rat(408234) serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
domestic guinea pig(101788286) serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
naked mole-rat(101719243) serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
cow(767993) serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
sheep(101110332) serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
chicken(770729) serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
domestic cat(101086969) serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
dog(611439) serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021114 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021114 Rosetta Predictions human pricing
NM_001008870 Rosetta Predictions rat pricing
NM_183284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143898 predicted 239
2 SASI_Hs01_00143899 predicted 345
3 SASI_Hs01_00143900 predicted 356
4 SASI_Hs01_00143902 predicted 341
5 SASI_Hs01_00143903 predicted 234
6 SASI_Hs02_00354610 predicted 352
7 SASI_Hs01_00143905 predicted 235
8 SASI_Hs01_00143906 predicted 348
9 SASI_Hs02_00354611 predicted 225
10 SASI_Hs02_00354612 predicted 231
11 SASI_Hs01_00143897 predicted 361
12 SASI_Hs01_00143901 predicted 281
13 SASI_Hs01_00143904 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199396 predicted 210
2 SASI_Rn02_00199397 predicted 212
3 SASI_Rn02_00199398 predicted 246
4 SASI_Rn02_00199399 predicted 208
5 SASI_Rn02_00199400 predicted 215
6 SASI_Rn02_00199401 predicted 244
7 SASI_Rn02_00199402 predicted 216
8 SASI_Rn02_00199403 predicted 211
9 SASI_Rn02_00199404 predicted 229
10 SASI_Rn02_00199405 predicted 206
11 SASI_Rn01_00099269 predicted 141
12 SASI_Rn01_00099270 predicted 64
13 SASI_Rn01_00099271 predicted 167
14 SASI_Rn01_00099272 predicted 185
15 SASI_Rn01_00099273 predicted 162
16 SASI_Rn01_00099274 predicted 94
17 SASI_Rn01_00099275 predicted 186
18 SASI_Rn01_00099276 predicted 77
19 SASI_Rn01_00099277 predicted 30
20 SASI_Rn01_00099278 predicted 158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158695 predicted 241
2 SASI_Mm02_00350383 predicted 288
3 SASI_Mm01_00158696 predicted 266
4 SASI_Mm01_00158697 predicted 286
5 SASI_Mm01_00158698 predicted 295
6 SASI_Mm01_00158700 predicted 289
7 SASI_Mm01_00158701 predicted 327
8 SASI_Mm01_00158702 predicted 246
9 SASI_Mm01_00158703 predicted 236
10 SASI_Mm01_00158704 predicted 375
11 SASI_Mm01_00158699 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183284
SPINK2 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183284.1-434s1c1
Sequence:CCGGGCATGATACTTGTTCACAGAACTCGAGTTCTGTGAACAAGTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-143s1c1
Sequence:CCGGCTCTTCCGATTCTCAAATCATCTCGAGATGATTTGAGAATCGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-253s1c1
Sequence:CCGGTGAACACTTACAGCAATGAATCTCGAGATTCATTGCTGTAAGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-242s1c1
Sequence:CCGGCGGAACGGATATGAACACTTACTCGAGTAAGTGTTCATATCCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-181s1c1
Sequence:CCGGGAACACCAGACTGTGGTCATTCTCGAGAATGACCACAGTCTGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183284
SPINK2 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183284.1-434s1c1
Sequence:CCGGGCATGATACTTGTTCACAGAACTCGAGTTCTGTGAACAAGTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-143s1c1
Sequence:CCGGCTCTTCCGATTCTCAAATCATCTCGAGATGATTTGAGAATCGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-253s1c1
Sequence:CCGGTGAACACTTACAGCAATGAATCTCGAGATTCATTGCTGTAAGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-242s1c1
Sequence:CCGGCGGAACGGATATGAACACTTACTCGAGTAAGTGTTCATATCCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-181s1c1
Sequence:CCGGGAACACCAGACTGTGGTCATTCTCGAGAATGACCACAGTCTGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183284
SPINK2 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183284.1-434s1c1
Sequence:CCGGGCATGATACTTGTTCACAGAACTCGAGTTCTGTGAACAAGTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-143s1c1
Sequence:CCGGCTCTTCCGATTCTCAAATCATCTCGAGATGATTTGAGAATCGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-253s1c1
Sequence:CCGGTGAACACTTACAGCAATGAATCTCGAGATTCATTGCTGTAAGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-242s1c1
Sequence:CCGGCGGAACGGATATGAACACTTACTCGAGTAAGTGTTCATATCCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183284.1-181s1c1
Sequence:CCGGGAACACCAGACTGTGGTCATTCTCGAGAATGACCACAGTCTGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021114
SPINK2 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-248s1c1
Sequence:CCGGCAATGAATGTACTCTGTGCATCTCGAGATGCACAGAGTACATTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-235s1c1
Sequence:CCGGTGTCCACTTATGCCAATGAATCTCGAGATTCATTGGCATAAGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-166s1c1
Sequence:CCGGCGCCAAACTGCTCTCAGTATACTCGAGTATACTGAGAGCAGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021114.1-368s1c1
Sequence:CCGGGCAGACTAGATAAATTGCATTCTCGAGAATGCAATTTATCTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-271s21c1
Sequence:CCGGTCAGGGAAGGTGGTCATAATACTCGAGTATTATGACCACCTTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-191s21c1
Sequence:CCGGAGGATGTCCCAGACACTTTAACTCGAGTTAAAGTGTCTGGGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-131s1c2
Sequence:CCGGGATCCCTCAATTTGGTCTGTTCTCGAGAACAGACCAAATTGAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-315s21c1
Sequence:CCGGTGCTGATGGAGCAGTTTACAGCTCGAGCTGTAAACTGCTCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021114
SPINK2 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-248s1c1
Sequence:CCGGCAATGAATGTACTCTGTGCATCTCGAGATGCACAGAGTACATTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-235s1c1
Sequence:CCGGTGTCCACTTATGCCAATGAATCTCGAGATTCATTGGCATAAGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-166s1c1
Sequence:CCGGCGCCAAACTGCTCTCAGTATACTCGAGTATACTGAGAGCAGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021114.1-368s1c1
Sequence:CCGGGCAGACTAGATAAATTGCATTCTCGAGAATGCAATTTATCTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-271s21c1
Sequence:CCGGTCAGGGAAGGTGGTCATAATACTCGAGTATTATGACCACCTTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-191s21c1
Sequence:CCGGAGGATGTCCCAGACACTTTAACTCGAGTTAAAGTGTCTGGGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-131s1c2
Sequence:CCGGGATCCCTCAATTTGGTCTGTTCTCGAGAACAGACCAAATTGAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-315s21c1
Sequence:CCGGTGCTGATGGAGCAGTTTACAGCTCGAGCTGTAAACTGCTCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021114
SPINK2 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-248s1c1
Sequence:CCGGCAATGAATGTACTCTGTGCATCTCGAGATGCACAGAGTACATTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-235s1c1
Sequence:CCGGTGTCCACTTATGCCAATGAATCTCGAGATTCATTGGCATAAGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-166s1c1
Sequence:CCGGCGCCAAACTGCTCTCAGTATACTCGAGTATACTGAGAGCAGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021114.1-368s1c1
Sequence:CCGGGCAGACTAGATAAATTGCATTCTCGAGAATGCAATTTATCTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-271s21c1
Sequence:CCGGTCAGGGAAGGTGGTCATAATACTCGAGTATTATGACCACCTTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-191s21c1
Sequence:CCGGAGGATGTCCCAGACACTTTAACTCGAGTTAAAGTGTCTGGGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021114.1-131s1c2
Sequence:CCGGGATCCCTCAATTTGGTCTGTTCTCGAGAACAGACCAAATTGAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021114.2-315s21c1
Sequence:CCGGTGCTGATGGAGCAGTTTACAGCTCGAGCTGTAAACTGCTCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks