EMAIL THIS PAGE TO A FRIEND

SPINK4

serine peptidase inhibitor, Kazal type 4

Synonyms: PEC-60 PEC60
UniProtKB ID: O60575, Q2YDT7
Gene ID:
Mouse(20731) serine peptidase inhibitor, Kazal type 4
Rat(408233) serine peptidase inhibitor, Kazal type 4
domestic guinea pig(100722994) serine peptidase inhibitor, Kazal type 4
cow(616822) serine peptidase inhibitor, Kazal type 4
sheep(101104631) serine peptidase inhibitor, Kazal type 4
chicken(768734) serine peptidase inhibitor, Kazal type 4
domestic cat(101098749) serine peptidase inhibitor, Kazal type 4
dog(611774) serine peptidase inhibitor, Kazal type 4
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007286 Anti-SPINK4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014471 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058621 MISSION® esiRNA esiRNA human SPINK4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014471 Rosetta Predictions human pricing
NM_001008871 Rosetta Predictions rat pricing
NM_011463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054382 predicted 285
2 SASI_Hs01_00054383 predicted 172
3 SASI_Hs02_00345703 predicted 317
4 SASI_Hs01_00054384 predicted 123
5 SASI_Hs01_00054385 predicted 237
6 SASI_Hs01_00054387 predicted 175
7 SASI_Hs01_00054388 predicted 286
8 SASI_Hs02_00345704 predicted 98
9 SASI_Hs01_00054389 predicted 114
10 SASI_Hs01_00054390 predicted 275
11 SASI_Hs01_00054386 predicted 241
12 SASI_Hs01_00054391 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073006 predicted 129
2 SASI_Rn01_00073007 predicted 61
3 SASI_Rn01_00073008 predicted 164
4 SASI_Rn02_00199406 predicted 129
5 SASI_Rn01_00073009 predicted 127
6 SASI_Rn01_00073010 predicted 128
7 SASI_Rn01_00073011 predicted 72
8 SASI_Rn01_00073012 predicted 158
9 SASI_Rn01_00073014 predicted 123
10 SASI_Rn01_00073015 predicted 84
11 SASI_Rn01_00073013 predicted 80
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190709 predicted 318
2 SASI_Mm01_00190710 predicted 197
3 SASI_Mm01_00190711 predicted 257
4 SASI_Mm01_00190712 predicted 187
5 SASI_Mm01_00190713 predicted 351
6 SASI_Mm01_00190714 predicted 105
7 SASI_Mm02_00320722 predicted 299
8 SASI_Mm01_00190715 predicted 309
9 SASI_Mm01_00190716 predicted 147
10 SASI_Mm01_00190717 predicted 308
11 SASI_Mm01_00190718 predicted 58
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011463
SPINK4 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000079936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-218s1c1
Sequence:CCGGTGGCACGGATGGGCTCACATACTCGAGTATGTGAGCCCATCCGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-154s1c1
Sequence:CCGGGAATGCCCTTCTGTGAGCACACTCGAGTGTGCTCACAGAAGGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-285s1c1
Sequence:CCGGGACATTCAAATCATGAAGGATCTCGAGATCCTTCATGATTTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-291s1c1
Sequence:CCGGCAAATCATGAAGGATGGCCAACTCGAGTTGGCCATCCTTCATGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011463
SPINK4 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000079936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-218s1c1
Sequence:CCGGTGGCACGGATGGGCTCACATACTCGAGTATGTGAGCCCATCCGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-154s1c1
Sequence:CCGGGAATGCCCTTCTGTGAGCACACTCGAGTGTGCTCACAGAAGGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-285s1c1
Sequence:CCGGGACATTCAAATCATGAAGGATCTCGAGATCCTTCATGATTTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-291s1c1
Sequence:CCGGCAAATCATGAAGGATGGCCAACTCGAGTTGGCCATCCTTCATGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011463
SPINK4 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000079936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-218s1c1
Sequence:CCGGTGGCACGGATGGGCTCACATACTCGAGTATGTGAGCCCATCCGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-154s1c1
Sequence:CCGGGAATGCCCTTCTGTGAGCACACTCGAGTGTGCTCACAGAAGGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-285s1c1
Sequence:CCGGGACATTCAAATCATGAAGGATCTCGAGATCCTTCATGATTTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011463.1-291s1c1
Sequence:CCGGCAAATCATGAAGGATGGCCAACTCGAGTTGGCCATCCTTCATGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014471
SPINK4 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-180s1c1
Sequence:CCGGGATGGGCTCACATATACGAATCTCGAGATTCGTATATGTGAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-53s1c1
Sequence:CCGGCCTCCTTGTTGTGGACAGGGACTCGAGTCCCTGTCCACAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-173s1c1
Sequence:CCGGCGGCACTGATGGGCTCACATACTCGAGTATGTGAGCCCATCAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-130s1c1
Sequence:CCGGTGGTAGAGTCTCCAACCTGTTCTCGAGAACAGGTTGGAGACTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-114s1c1
Sequence:CCGGCCCATCTGTGAACACATGGTACTCGAGTACCATGTGTTCACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014471.1-233s21c1
Sequence:CCGGCAAACAGGACATCCAGATCATCTCGAGATGATCTGGATGTCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014471.1-250s21c1
Sequence:CCGGTCATGAAAGATGGCAAATGCTCTCGAGAGCATTTGCCATCTTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014471
SPINK4 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-180s1c1
Sequence:CCGGGATGGGCTCACATATACGAATCTCGAGATTCGTATATGTGAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-53s1c1
Sequence:CCGGCCTCCTTGTTGTGGACAGGGACTCGAGTCCCTGTCCACAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-173s1c1
Sequence:CCGGCGGCACTGATGGGCTCACATACTCGAGTATGTGAGCCCATCAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-130s1c1
Sequence:CCGGTGGTAGAGTCTCCAACCTGTTCTCGAGAACAGGTTGGAGACTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-114s1c1
Sequence:CCGGCCCATCTGTGAACACATGGTACTCGAGTACCATGTGTTCACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014471.1-233s21c1
Sequence:CCGGCAAACAGGACATCCAGATCATCTCGAGATGATCTGGATGTCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014471.1-250s21c1
Sequence:CCGGTCATGAAAGATGGCAAATGCTCTCGAGAGCATTTGCCATCTTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014471
SPINK4 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-180s1c1
Sequence:CCGGGATGGGCTCACATATACGAATCTCGAGATTCGTATATGTGAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-53s1c1
Sequence:CCGGCCTCCTTGTTGTGGACAGGGACTCGAGTCCCTGTCCACAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-173s1c1
Sequence:CCGGCGGCACTGATGGGCTCACATACTCGAGTATGTGAGCCCATCAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-130s1c1
Sequence:CCGGTGGTAGAGTCTCCAACCTGTTCTCGAGAACAGGTTGGAGACTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014471.1-114s1c1
Sequence:CCGGCCCATCTGTGAACACATGGTACTCGAGTACCATGTGTTCACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014471.1-233s21c1
Sequence:CCGGCAAACAGGACATCCAGATCATCTCGAGATGATCTGGATGTCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014471.1-250s21c1
Sequence:CCGGTCATGAAAGATGGCAAATGCTCTCGAGAGCATTTGCCATCTTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks