EMAIL THIS PAGE TO A FRIEND

SPINK5

serine peptidase inhibitor, Kazal type 5

Synonyms: LEKTI LETKI NETS NS VAKTI
Gene ID:
Human(11005) Summary: This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The inhibitor may play a role in skin and hair morphogenesis and anti-inflammatory and/or antimicrobial protection of mucous epithelia. Mutations may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(72432) serine peptidase inhibitor, Kazal type 5
Rat(361319) serine peptidase inhibitor, Kazal type 5
chicken(416235) serine peptidase inhibitor, Kazal type 5 (ovoinhibitor)
Horse(100071873) serine peptidase inhibitor, Kazal type 5
domestic cat(101086696) serine peptidase inhibitor, Kazal type 5
dog(478055) serine peptidase inhibitor, Kazal type 5
cow(526637) serine peptidase inhibitor, Kazal type 5
sheep(101116141) serine peptidase inhibitor, Kazal type 5
domestic guinea pig(100732979) serine peptidase inhibitor, Kazal type 5
naked mole-rat(101705936) serine peptidase inhibitor, Kazal type 5
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006846 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_283487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127698 Rosetta Predictions human pricing
NM_001127699 Rosetta Predictions human pricing
NM_006846 Rosetta Predictions human pricing
XM_001056195 Rosetta Predictions rat pricing
XM_341607 Rosetta Predictions rat pricing
NM_001081180 Rosetta Predictions mouse pricing
XM_283487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330184 predicted 3410
2 SASI_Hs02_00330185 predicted 231
3 SASI_Hs02_00330186 predicted 221
4 SASI_Hs02_00330187 predicted 2777
5 SASI_Hs02_00330188 predicted 3355
6 SASI_Hs02_00330189 predicted 636
7 SASI_Hs02_00330190 predicted 416
8 SASI_Hs02_00330191 predicted 404
9 SASI_Hs02_00330192 predicted 3360
10 SASI_Hs02_00330193 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330194 predicted 226
2 SASI_Hs02_00330195 predicted 702
3 SASI_Hs02_00330196 predicted 640
4 SASI_Hs02_00330197 predicted 316
5 SASI_Hs02_00330198 predicted 421
6 SASI_Hs02_00330199 predicted 522
7 SASI_Hs02_00330200 predicted 407
8 SASI_Hs02_00330201 predicted 630
9 SASI_Hs02_00330202 predicted 464
10 SASI_Hs02_00330203 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150088 predicted 229
2 SASI_Hs02_00342438 predicted 2779
3 SASI_Hs02_00342439 predicted 222
4 SASI_Hs02_00342440 predicted 2978
5 SASI_Hs01_00150091 predicted 3266
6 SASI_Hs01_00150094 predicted 637
7 SASI_Hs02_00342441 predicted 2913
8 SASI_Hs02_00342442 predicted 3066
9 SASI_Hs01_00150096 predicted 424
10 SASI_Hs01_00150097 predicted 525
11 SASI_Hs01_00150089 predicted 3296
12 SASI_Hs01_00150090 predicted 3327
13 SASI_Hs01_00150092 predicted 539
14 SASI_Hs01_00150093 predicted 289
15 SASI_Hs01_00150095 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282388 predicted 3119
2 SASI_Rn02_00282389 predicted 1625
3 SASI_Rn02_00282390 predicted 3062
4 SASI_Rn02_00282391 predicted 512
5 SASI_Rn02_00282392 predicted 1202
6 SASI_Rn02_00282393 predicted 1234
7 SASI_Rn02_00282394 predicted 453
8 SASI_Rn02_00282395 predicted 3014
9 SASI_Rn02_00282396 predicted 1148
10 SASI_Rn02_00282397 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393129 predicted 1538
2 SASI_Rn02_00393130 predicted 1623
3 SASI_Rn02_00393131 predicted 1345
4 SASI_Rn02_00393132 predicted 1537
5 SASI_Rn02_00393133 predicted 1710
6 SASI_Rn02_00393134 predicted 1622
7 SASI_Rn02_00393135 predicted 1623
8 SASI_Rn02_00393136 predicted 1349
9 SASI_Rn02_00393137 predicted 1707
10 SASI_Rn02_00393138 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295971 predicted 441
2 SASI_Mm02_00295972 predicted 1147
3 SASI_Mm02_00295973 predicted 333
4 SASI_Mm02_00295974 predicted 631
5 SASI_Mm02_00295975 predicted 853
6 SASI_Mm02_00295976 predicted 1300
7 SASI_Mm02_00295977 predicted 237
8 SASI_Mm02_00295978 predicted 419
9 SASI_Mm02_00295979 predicted 499
10 SASI_Mm02_00295980 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212935 predicted 446
2 SASI_Mm01_00212936 predicted 1153
3 SASI_Mm01_00212937 predicted 640
4 SASI_Mm01_00212938 predicted 854
5 SASI_Mm01_00212939 predicted 1299
6 SASI_Mm01_00212940 predicted 252
7 SASI_Mm01_00212941 predicted 422
8 SASI_Mm01_00212942 predicted 505
9 SASI_Mm01_00212943 predicted 575
10 SASI_Mm01_00212944 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006846
SPINK5 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-3065s21c1
Sequence:CCGGGTATTGCCCAGGATAGGTTATCTCGAGATAACCTATCCTGGGCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-2385s21c1
Sequence:CCGGAGGATACATGTGATGAGTTTACTCGAGTAAACTCATCACATGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-1381s21c1
Sequence:CCGGGTGTAGTGAATACCGCAAATCCTCGAGGATTTGCGGTATTCACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-825s21c1
Sequence:CCGGGCAGGATGCATGGCAACAAATCTCGAGATTTGTTGCCATGCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-1772s21c1
Sequence:CCGGTGCAGTGAATATCGTCATTATCTCGAGATAATGACGATATTCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006846.1-3292s1c1
Sequence:CCGGCCTACCTTCACCATCTGTATACTCGAGTATACAGATGGTGAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-460s1c1
Sequence:CCGGCGGGTCCCAAATTGGTGTAAACTCGAGTTTACACCAATTTGGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-3051s1c1
Sequence:CCGGGCTATCTTTGTCCAAAGGATTCTCGAGAATCCTTTGGACAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-2765s1c1
Sequence:CCGGCCCTCAAATAATGCAAAGGATCTCGAGATCCTTTGCATTATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-1466s1c1
Sequence:CCGGGCCTTCTTTCAACAAGAAGAACTCGAGTTCTTCTTGTTGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006846
SPINK5 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-3065s21c1
Sequence:CCGGGTATTGCCCAGGATAGGTTATCTCGAGATAACCTATCCTGGGCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-2385s21c1
Sequence:CCGGAGGATACATGTGATGAGTTTACTCGAGTAAACTCATCACATGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-1381s21c1
Sequence:CCGGGTGTAGTGAATACCGCAAATCCTCGAGGATTTGCGGTATTCACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-825s21c1
Sequence:CCGGGCAGGATGCATGGCAACAAATCTCGAGATTTGTTGCCATGCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-1772s21c1
Sequence:CCGGTGCAGTGAATATCGTCATTATCTCGAGATAATGACGATATTCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006846.1-3292s1c1
Sequence:CCGGCCTACCTTCACCATCTGTATACTCGAGTATACAGATGGTGAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-460s1c1
Sequence:CCGGCGGGTCCCAAATTGGTGTAAACTCGAGTTTACACCAATTTGGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-3051s1c1
Sequence:CCGGGCTATCTTTGTCCAAAGGATTCTCGAGAATCCTTTGGACAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-2765s1c1
Sequence:CCGGCCCTCAAATAATGCAAAGGATCTCGAGATCCTTTGCATTATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-1466s1c1
Sequence:CCGGGCCTTCTTTCAACAAGAAGAACTCGAGTTCTTCTTGTTGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006846
SPINK5 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-3065s21c1
Sequence:CCGGGTATTGCCCAGGATAGGTTATCTCGAGATAACCTATCCTGGGCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-2385s21c1
Sequence:CCGGAGGATACATGTGATGAGTTTACTCGAGTAAACTCATCACATGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-1381s21c1
Sequence:CCGGGTGTAGTGAATACCGCAAATCCTCGAGGATTTGCGGTATTCACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-825s21c1
Sequence:CCGGGCAGGATGCATGGCAACAAATCTCGAGATTTGTTGCCATGCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006846.3-1772s21c1
Sequence:CCGGTGCAGTGAATATCGTCATTATCTCGAGATAATGACGATATTCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006846.1-3292s1c1
Sequence:CCGGCCTACCTTCACCATCTGTATACTCGAGTATACAGATGGTGAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-460s1c1
Sequence:CCGGCGGGTCCCAAATTGGTGTAAACTCGAGTTTACACCAATTTGGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-3051s1c1
Sequence:CCGGGCTATCTTTGTCCAAAGGATTCTCGAGAATCCTTTGGACAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-2765s1c1
Sequence:CCGGCCCTCAAATAATGCAAAGGATCTCGAGATCCTTTGCATTATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006846.1-1466s1c1
Sequence:CCGGGCCTTCTTTCAACAAGAAGAACTCGAGTTCTTCTTGTTGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283487
SPINK5 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283487.2-4019s1c1
Sequence:CCGGCCACTATTAGTACCTCTAATTCTCGAGAATTAGAGGTACTAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-2496s1c1
Sequence:CCGGGCGTGAAGCTAATGAAAGAAACTCGAGTTTCTTTCATTAGCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-1453s1c1
Sequence:CCGGGCAAGTGTATTCCTACTAGAACTCGAGTTCTAGTAGGAATACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-3013s1c1
Sequence:CCGGCGTCAGACTAATACACGCATACTCGAGTATGCGTGTATTAGTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-1184s1c1
Sequence:CCGGCCAGGAAGAATGGACAACTATCTCGAGATAGTTGTCCATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283487
SPINK5 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283487.2-4019s1c1
Sequence:CCGGCCACTATTAGTACCTCTAATTCTCGAGAATTAGAGGTACTAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-2496s1c1
Sequence:CCGGGCGTGAAGCTAATGAAAGAAACTCGAGTTTCTTTCATTAGCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-1453s1c1
Sequence:CCGGGCAAGTGTATTCCTACTAGAACTCGAGTTCTAGTAGGAATACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-3013s1c1
Sequence:CCGGCGTCAGACTAATACACGCATACTCGAGTATGCGTGTATTAGTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-1184s1c1
Sequence:CCGGCCAGGAAGAATGGACAACTATCTCGAGATAGTTGTCCATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283487
SPINK5 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283487.2-4019s1c1
Sequence:CCGGCCACTATTAGTACCTCTAATTCTCGAGAATTAGAGGTACTAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-2496s1c1
Sequence:CCGGGCGTGAAGCTAATGAAAGAAACTCGAGTTTCTTTCATTAGCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-1453s1c1
Sequence:CCGGGCAAGTGTATTCCTACTAGAACTCGAGTTCTAGTAGGAATACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-3013s1c1
Sequence:CCGGCGTCAGACTAATACACGCATACTCGAGTATGCGTGTATTAGTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283487.2-1184s1c1
Sequence:CCGGCCAGGAAGAATGGACAACTATCTCGAGATAGTTGTCCATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks