EMAIL THIS PAGE TO A FRIEND

SPINK6

serine peptidase inhibitor, Kazal type 6

Synonyms: BUSI2 UNQ844
UniProtKB ID: Q6UWN8, E0X656, Q8N5P0
Gene ID:
Human(404203) Summary: The protein encoded by this gene is a Kazal-type serine protease inhibitor that acts on kallikrein-related peptidases in the skin. Two transcript variants the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
Mouse(433180) serine peptidase inhibitor, Kazal type 6
Rat(408235) serine peptidase inhibitor, Kazal type 6
domestic guinea pig(100722107) serine peptidase inhibitor, Kazal type 6
cow(100335759) serine peptidase inhibitor, Kazal type 6
sheep(101116570) serine peptidase inhibitor, Kazal type 6
dog(100685732) serine peptidase inhibitor, Kazal type 6
domestic cat(101086945) serine peptidase inhibitor, Kazal type 6
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_484725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_205841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205841 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205841 Rosetta Predictions human pricing
NM_001008874 Rosetta Predictions rat pricing
NM_001013797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127025 predicted 405
2 SASI_Hs01_00127026 predicted 392
3 SASI_Hs01_00127027 predicted 328
4 SASI_Hs01_00127028 predicted 450
5 SASI_Hs01_00127029 predicted 405
6 SASI_Hs01_00127030 predicted 331
7 SASI_Hs01_00127031 predicted 402
8 SASI_Hs02_00373469 predicted 394
9 SASI_Hs01_00127032 predicted 376
10 SASI_Hs01_00127033 predicted 431
11 SASI_Hs01_00127034 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051391 predicted 224
2 SASI_Rn01_00051392 predicted 137
3 SASI_Rn01_00051393 predicted 129
4 SASI_Rn01_00051394 predicted 220
5 SASI_Rn01_00051395 predicted 133
6 SASI_Rn01_00051396 predicted 226
7 SASI_Rn01_00051397 predicted 118
8 SASI_Rn01_00051398 predicted 134
9 SASI_Rn01_00051399 predicted 112
10 SASI_Rn01_00051400 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044526 predicted 209
2 SASI_Mm01_00044527 predicted 198
3 SASI_Mm01_00044528 predicted 204
4 SASI_Mm01_00044529 predicted 214
5 SASI_Mm01_00044530 predicted 192
6 SASI_Mm01_00044531 predicted 220
7 SASI_Mm01_00044532 predicted 213
8 SASI_Mm01_00044533 predicted 215
9 SASI_Mm01_00044534 predicted 220
10 SASI_Mm01_00044535 predicted 191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484725
SPINK6 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-761s1c1
Sequence:CCGGGCCAGACATATGGGAATAAATCTCGAGATTTATTCCCATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-672s1c1
Sequence:CCGGGCATCGTCTCTTTCAAATTAACTCGAGTTAATTTGAAAGAGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-670s1c1
Sequence:CCGGAGGCATCGTCTCTTTCAAATTCTCGAGAATTTGAAAGAGACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484725.2-877s1c1
Sequence:CCGGGCCTGTCTTCACTCACACTTACTCGAGTAAGTGTGAGTGAAGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-448s1c1
Sequence:CCGGGTAGCAGTTAAAGACTCGAATCTCGAGATTCGAGTCTTTAACTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484725
SPINK6 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-761s1c1
Sequence:CCGGGCCAGACATATGGGAATAAATCTCGAGATTTATTCCCATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-672s1c1
Sequence:CCGGGCATCGTCTCTTTCAAATTAACTCGAGTTAATTTGAAAGAGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-670s1c1
Sequence:CCGGAGGCATCGTCTCTTTCAAATTCTCGAGAATTTGAAAGAGACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484725.2-877s1c1
Sequence:CCGGGCCTGTCTTCACTCACACTTACTCGAGTAAGTGTGAGTGAAGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-448s1c1
Sequence:CCGGGTAGCAGTTAAAGACTCGAATCTCGAGATTCGAGTCTTTAACTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484725
SPINK6 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-761s1c1
Sequence:CCGGGCCAGACATATGGGAATAAATCTCGAGATTTATTCCCATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-672s1c1
Sequence:CCGGGCATCGTCTCTTTCAAATTAACTCGAGTTAATTTGAAAGAGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-670s1c1
Sequence:CCGGAGGCATCGTCTCTTTCAAATTCTCGAGAATTTGAAAGAGACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484725.2-877s1c1
Sequence:CCGGGCCTGTCTTCACTCACACTTACTCGAGTAAGTGTGAGTGAAGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484725.2-448s1c1
Sequence:CCGGGTAGCAGTTAAAGACTCGAATCTCGAGATTCGAGTCTTTAACTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205841
SPINK6 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205841.1-506s1c1
Sequence:CCGGGCCAATGTTTCTTGGTGACTTCTCGAGAAGTCACCAAGAAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-411s1c1
Sequence:CCGGGCCAGACATATGGCAATAAATCTCGAGATTTATTGCCATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-460s1c1
Sequence:CCGGTGGTGGAAAGATTAGCCTAAACTCGAGTTTAGGCTAATCTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-370s1c1
Sequence:CCGGCTACTGCACTCGGGAATCTAACTCGAGTTAGATTCCCGAGTGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-334s1c1
Sequence:CCGGACAGGTTGACTGTGGTGAGTTCTCGAGAACTCACCACAGTCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205841.2-381s21c1
Sequence:CCGGGGGAATCTAACCCACACTGTGCTCGAGCACAGTGTGGGTTAGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205841.2-437s21c1
Sequence:CCGGTTCTGTAAGGCCATAGTGAAACTCGAGTTTCACTATGGCCTTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205841
SPINK6 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205841.1-506s1c1
Sequence:CCGGGCCAATGTTTCTTGGTGACTTCTCGAGAAGTCACCAAGAAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-411s1c1
Sequence:CCGGGCCAGACATATGGCAATAAATCTCGAGATTTATTGCCATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-460s1c1
Sequence:CCGGTGGTGGAAAGATTAGCCTAAACTCGAGTTTAGGCTAATCTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-370s1c1
Sequence:CCGGCTACTGCACTCGGGAATCTAACTCGAGTTAGATTCCCGAGTGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-334s1c1
Sequence:CCGGACAGGTTGACTGTGGTGAGTTCTCGAGAACTCACCACAGTCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205841.2-381s21c1
Sequence:CCGGGGGAATCTAACCCACACTGTGCTCGAGCACAGTGTGGGTTAGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205841.2-437s21c1
Sequence:CCGGTTCTGTAAGGCCATAGTGAAACTCGAGTTTCACTATGGCCTTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205841
SPINK6 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205841.1-506s1c1
Sequence:CCGGGCCAATGTTTCTTGGTGACTTCTCGAGAAGTCACCAAGAAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-411s1c1
Sequence:CCGGGCCAGACATATGGCAATAAATCTCGAGATTTATTGCCATATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-460s1c1
Sequence:CCGGTGGTGGAAAGATTAGCCTAAACTCGAGTTTAGGCTAATCTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-370s1c1
Sequence:CCGGCTACTGCACTCGGGAATCTAACTCGAGTTAGATTCCCGAGTGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205841.1-334s1c1
Sequence:CCGGACAGGTTGACTGTGGTGAGTTCTCGAGAACTCACCACAGTCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205841.2-381s21c1
Sequence:CCGGGGGAATCTAACCCACACTGTGCTCGAGCACAGTGTGGGTTAGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205841.2-437s21c1
Sequence:CCGGTTCTGTAAGGCCATAGTGAAACTCGAGTTTCACTATGGCCTTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks