EMAIL THIS PAGE TO A FRIEND

SPINK7

serine peptidase inhibitor, Kazal type 7 (putative)

Synonyms: ECG2 ECRG2
UniProtKB ID: P58062, Q32LY0
Gene ID:
Mouse(408198) serine peptidase inhibitor, Kazal type 7 (putative)
Rat(408237) serine peptidase inhibitor, Kazal type 7
chicken(416236) serine peptidase inhibitor, Kazal type 7 (putative)
domestic cat(101088055) serine peptidase inhibitor, Kazal type 7 (putative)
dog(100686763) serine peptidase inhibitor, Kazal type 7 (putative)
cow(100295820) serine peptidase inhibitor, Kazal type 7 (putative)
sheep(101117075) serine peptidase inhibitor, Kazal type 7 (putative)
domestic guinea pig(100733264) serine peptidase inhibitor, Kazal type 7 (putative)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032566 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032566 Rosetta Predictions human pricing
NM_001002816 Rosetta Predictions rat pricing
NM_001001803 Rosetta Predictions mouse pricing
XR_035113 Rosetta Predictions mouse pricing
XR_035114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360081 predicted 207
2 SASI_Hs01_00174529 predicted 202
3 SASI_Hs01_00174530 predicted 205
4 SASI_Hs01_00174531 predicted 243
5 SASI_Hs02_00360082 predicted 216
6 SASI_Hs01_00174532 predicted 236
7 SASI_Hs02_00360083 predicted 242
8 SASI_Hs01_00174536 predicted 227
9 SASI_Hs01_00174537 predicted 219
10 SASI_Hs01_00174538 predicted 221
11 SASI_Hs01_00174533 predicted 234
12 SASI_Hs01_00174534 predicted 211
13 SASI_Hs01_00174535 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090763 predicted 56
2 SASI_Rn01_00090764 predicted 168
3 SASI_Rn01_00090765 predicted 116
4 SASI_Rn01_00090766 predicted 55
5 SASI_Rn01_00090767 predicted 122
6 SASI_Rn01_00090768 predicted 122
7 SASI_Rn01_00090769 predicted 132
8 SASI_Rn01_00090770 predicted 151
9 SASI_Rn01_00090771 predicted 150
10 SASI_Rn01_00090772 predicted 130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095231 predicted 25
2 SASI_Mm01_00095232 predicted 140
3 SASI_Mm01_00095233 predicted 59
4 SASI_Mm01_00095234 predicted 54
5 SASI_Mm01_00095235 predicted 56
6 SASI_Mm01_00095236 predicted 160
7 SASI_Mm01_00095237 predicted 138
8 SASI_Mm01_00095238 predicted 168
9 SASI_Mm01_00095239 predicted 179
10 SASI_Mm01_00095240 predicted 33
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480056 predicted 24
2 SASI_Mm02_00480057 predicted 137
3 SASI_Mm02_00480058 predicted 60
4 SASI_Mm02_00480059 predicted 53
5 SASI_Mm02_00480060 predicted 168
6 SASI_Mm02_00480061 predicted 154
7 SASI_Mm02_00480062 predicted 135
8 SASI_Mm02_00480063 predicted 160
9 SASI_Mm02_00480064 predicted 171
10 SASI_Mm02_00480065 predicted 173
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480066 predicted 24
2 SASI_Mm02_00480067 predicted 137
3 SASI_Mm02_00480068 predicted 62
4 SASI_Mm02_00480069 predicted 47
5 SASI_Mm02_00480070 predicted 169
6 SASI_Mm02_00480071 predicted 155
7 SASI_Mm02_00480072 predicted 130
8 SASI_Mm02_00480073 predicted 161
9 SASI_Mm02_00480074 predicted 171
10 SASI_Mm02_00480075 predicted 169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032566
SPINK7 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 7 (putative)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-152s21c1
Sequence:CCGGGCAGCATTTACAAGAAGTATCCTCGAGGATACTTCTTGTAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-112s21c1
Sequence:CCGGAGCTCAGAAGCTGCTAGTCTGCTCGAGCAGACTAGCAGCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-298s21c1
Sequence:CCGGCACGATGGAAGTTGCTAAATTCTCGAGAATTTAGCAACTTCCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032566.2-328s1c1
Sequence:CCGGCATAGAGAGAAAGGAATGATACTCGAGTATCATTCCTTTCTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-84s1c1
Sequence:CCGGGCTCTGTACAGTGGTCTATTTCTCGAGAAATAGACCACTGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-223s1c1
Sequence:CCGGGACTACATCACCTATGGGAATCTCGAGATTCCCATAGGTGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-204s1c1
Sequence:CCGGCCTACCAGTTTGTGGTTCTGACTCGAGTCAGAACCACAAACTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-193s1c1
Sequence:CCGGCCCATCACATACCTACCAGTTCTCGAGAACTGGTAGGTATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032566
SPINK7 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 7 (putative)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-152s21c1
Sequence:CCGGGCAGCATTTACAAGAAGTATCCTCGAGGATACTTCTTGTAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-112s21c1
Sequence:CCGGAGCTCAGAAGCTGCTAGTCTGCTCGAGCAGACTAGCAGCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-298s21c1
Sequence:CCGGCACGATGGAAGTTGCTAAATTCTCGAGAATTTAGCAACTTCCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032566.2-328s1c1
Sequence:CCGGCATAGAGAGAAAGGAATGATACTCGAGTATCATTCCTTTCTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-84s1c1
Sequence:CCGGGCTCTGTACAGTGGTCTATTTCTCGAGAAATAGACCACTGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-223s1c1
Sequence:CCGGGACTACATCACCTATGGGAATCTCGAGATTCCCATAGGTGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-204s1c1
Sequence:CCGGCCTACCAGTTTGTGGTTCTGACTCGAGTCAGAACCACAAACTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-193s1c1
Sequence:CCGGCCCATCACATACCTACCAGTTCTCGAGAACTGGTAGGTATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032566
SPINK7 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 7 (putative)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-152s21c1
Sequence:CCGGGCAGCATTTACAAGAAGTATCCTCGAGGATACTTCTTGTAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-112s21c1
Sequence:CCGGAGCTCAGAAGCTGCTAGTCTGCTCGAGCAGACTAGCAGCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032566.2-298s21c1
Sequence:CCGGCACGATGGAAGTTGCTAAATTCTCGAGAATTTAGCAACTTCCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032566.2-328s1c1
Sequence:CCGGCATAGAGAGAAAGGAATGATACTCGAGTATCATTCCTTTCTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-84s1c1
Sequence:CCGGGCTCTGTACAGTGGTCTATTTCTCGAGAAATAGACCACTGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-223s1c1
Sequence:CCGGGACTACATCACCTATGGGAATCTCGAGATTCCCATAGGTGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-204s1c1
Sequence:CCGGCCTACCAGTTTGTGGTTCTGACTCGAGTCAGAACCACAAACTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032566.2-193s1c1
Sequence:CCGGCCCATCACATACCTACCAGTTCTCGAGAACTGGTAGGTATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001803
SPINK7 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 7 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-57s1c1
Sequence:CCGGCTCTGTGGACTGTGACATATACTCGAGTATATGTCACAGTCCACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-35s1c1
Sequence:CCGGCAGCAACCTATGTCTGCAACTCTCGAGAGTTGCAGACATAGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-65s1c1
Sequence:CCGGACTGTGACATATACAAGAAGTCTCGAGACTTCTTGTATATGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-29s1c1
Sequence:CCGGTCTTCGCAGCAACCTATGTCTCTCGAGAGACATAGGTTGCTGCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-72s1c1
Sequence:CCGGCATATACAAGAAGTACCCAGTCTCGAGACTGGGTACTTCTTGTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001803
SPINK7 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 7 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-57s1c1
Sequence:CCGGCTCTGTGGACTGTGACATATACTCGAGTATATGTCACAGTCCACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-35s1c1
Sequence:CCGGCAGCAACCTATGTCTGCAACTCTCGAGAGTTGCAGACATAGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-65s1c1
Sequence:CCGGACTGTGACATATACAAGAAGTCTCGAGACTTCTTGTATATGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-29s1c1
Sequence:CCGGTCTTCGCAGCAACCTATGTCTCTCGAGAGACATAGGTTGCTGCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-72s1c1
Sequence:CCGGCATATACAAGAAGTACCCAGTCTCGAGACTGGGTACTTCTTGTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001803
SPINK7 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 7 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-57s1c1
Sequence:CCGGCTCTGTGGACTGTGACATATACTCGAGTATATGTCACAGTCCACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-35s1c1
Sequence:CCGGCAGCAACCTATGTCTGCAACTCTCGAGAGTTGCAGACATAGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-65s1c1
Sequence:CCGGACTGTGACATATACAAGAAGTCTCGAGACTTCTTGTATATGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-29s1c1
Sequence:CCGGTCTTCGCAGCAACCTATGTCTCTCGAGAGACATAGGTTGCTGCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001803.1-72s1c1
Sequence:CCGGCATATACAAGAAGTACCCAGTCTCGAGACTGGGTACTTCTTGTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks