EMAIL THIS PAGE TO A FRIEND

SPINK8

serine peptidase inhibitor, Kazal type 8 (putative)

UniProtKB ID: P0C7L1
Gene ID:
Mouse(78709) serine peptidase inhibitor, Kazal type 8
Rat(301016) serine peptidase inhibitor, Kazal type 8
domestic guinea pig(100726227) serine peptidase inhibitor, Kazal type 8 (putative)
naked mole-rat(101698388) serine peptidase inhibitor, Kazal type 8 (putative)
sheep(101120530) serine peptidase inhibitor, Kazal type 8 (putative)
Horse(100630242) serine peptidase inhibitor, Kazal type 8 (putative)
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080525 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080525 Rosetta Predictions human pricing
XM_929352 Rosetta Predictions human pricing
NM_001106860 Rosetta Predictions rat pricing
NM_183136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315687 predicted 206
2 SASI_Hs02_00315688 predicted 395
3 SASI_Hs02_00315689 predicted 294
4 SASI_Hs02_00315690 predicted 387
5 SASI_Hs02_00315691 predicted 403
6 SASI_Hs02_00315692 predicted 286
7 SASI_Hs02_00315693 predicted 261
8 SASI_Hs02_00315694 predicted 284
9 SASI_Hs02_00315695 predicted 323
10 SASI_Hs02_00315696 predicted 8
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250594 predicted 215
2 SASI_Hs01_00250595 predicted 294
3 SASI_Hs01_00250596 predicted 83
4 SASI_Hs01_00250597 predicted 337
5 SASI_Hs01_00250598 predicted 50
6 SASI_Hs01_00250599 predicted 244
7 SASI_Hs01_00250600 predicted 262
8 SASI_Hs01_00250601 predicted 325
9 SASI_Hs01_00250602 predicted 13
10 SASI_Hs01_00250603 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223116 predicted 243
2 SASI_Rn02_00223117 predicted 403
3 SASI_Rn02_00223118 predicted 306
4 SASI_Rn02_00223119 predicted 273
5 SASI_Rn02_00223120 predicted 356
6 SASI_Rn02_00223121 predicted 349
7 SASI_Rn02_00223122 predicted 352
8 SASI_Rn02_00223123 predicted 296
9 SASI_Rn02_00223124 predicted 381
10 SASI_Rn02_00223125 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143960 predicted 432
2 SASI_Mm01_00143961 predicted 271
3 SASI_Mm01_00143962 predicted 312
4 SASI_Mm02_00350142 predicted 307
5 SASI_Mm01_00143963 predicted 302
6 SASI_Mm01_00143964 predicted 435
7 SASI_Mm01_00143967 predicted 338
8 SASI_Mm01_00143968 predicted 425
9 SASI_Mm02_00350143 predicted 330
10 SASI_Mm02_00350144 predicted 426
11 SASI_Mm01_00143965 predicted 376
12 SASI_Mm01_00143966 predicted 347
13 SASI_Mm01_00143969 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183136
SPINK8 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 8 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183136.1-438s1c1
Sequence:CCGGCTCTTCAAAGATACCCAGTTTCTCGAGAAACTGGGTATCTTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-193s1c1
Sequence:CCGGCCTTCCTATGAACTTTCACATCTCGAGATGTGAAAGTTCATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-298s1c1
Sequence:CCGGTGAGCCTATATGTGGCAGCAACTCGAGTTGCTGCCACATATAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-376s1c1
Sequence:CCGGGATGAGTCTGAACACTGATAACTCGAGTTATCAGTGTTCAGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-242s1c1
Sequence:CCGGGCCTTGTGCATCAAGAATATACTCGAGTATATTCTTGATGCACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183136
SPINK8 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 8 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183136.1-438s1c1
Sequence:CCGGCTCTTCAAAGATACCCAGTTTCTCGAGAAACTGGGTATCTTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-193s1c1
Sequence:CCGGCCTTCCTATGAACTTTCACATCTCGAGATGTGAAAGTTCATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-298s1c1
Sequence:CCGGTGAGCCTATATGTGGCAGCAACTCGAGTTGCTGCCACATATAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-376s1c1
Sequence:CCGGGATGAGTCTGAACACTGATAACTCGAGTTATCAGTGTTCAGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-242s1c1
Sequence:CCGGGCCTTGTGCATCAAGAATATACTCGAGTATATTCTTGATGCACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183136
SPINK8 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 8 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183136.1-438s1c1
Sequence:CCGGCTCTTCAAAGATACCCAGTTTCTCGAGAAACTGGGTATCTTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-193s1c1
Sequence:CCGGCCTTCCTATGAACTTTCACATCTCGAGATGTGAAAGTTCATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-298s1c1
Sequence:CCGGTGAGCCTATATGTGGCAGCAACTCGAGTTGCTGCCACATATAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-376s1c1
Sequence:CCGGGATGAGTCTGAACACTGATAACTCGAGTTATCAGTGTTCAGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183136.1-242s1c1
Sequence:CCGGGCCTTGTGCATCAAGAATATACTCGAGTATATTCTTGATGCACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080525
SPINK8 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 8 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-261s21c1
Sequence:CCGGTAAACTGTATGATGGACAATGCTCGAGCATTGTCCATCATACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-189s21c1
Sequence:CCGGCAGTGACCAGGTTACCTACAGCTCGAGCTGTAGGTAACCTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-164s21c1
Sequence:CCGGTCAAGCCCAGTGAACCTATTTCTCGAGAAATAGGTTCACTGGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-46s21c1
Sequence:CCGGATGTGGATGGCCTTTGCAATTCTCGAGAATTGCAAAGGCCATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-239s21c1
Sequence:CCGGTATTTGAAGGGCTTAACATAACTCGAGTTATGTTAAGCCCTTCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080525
SPINK8 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 8 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-261s21c1
Sequence:CCGGTAAACTGTATGATGGACAATGCTCGAGCATTGTCCATCATACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-189s21c1
Sequence:CCGGCAGTGACCAGGTTACCTACAGCTCGAGCTGTAGGTAACCTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-164s21c1
Sequence:CCGGTCAAGCCCAGTGAACCTATTTCTCGAGAAATAGGTTCACTGGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-46s21c1
Sequence:CCGGATGTGGATGGCCTTTGCAATTCTCGAGAATTGCAAAGGCCATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-239s21c1
Sequence:CCGGTATTTGAAGGGCTTAACATAACTCGAGTTATGTTAAGCCCTTCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080525
SPINK8 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 8 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-261s21c1
Sequence:CCGGTAAACTGTATGATGGACAATGCTCGAGCATTGTCCATCATACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-189s21c1
Sequence:CCGGCAGTGACCAGGTTACCTACAGCTCGAGCTGTAGGTAACCTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-164s21c1
Sequence:CCGGTCAAGCCCAGTGAACCTATTTCTCGAGAAATAGGTTCACTGGGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-46s21c1
Sequence:CCGGATGTGGATGGCCTTTGCAATTCTCGAGAATTGCAAAGGCCATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080525.1-239s21c1
Sequence:CCGGTATTTGAAGGGCTTAACATAACTCGAGTTATGTTAAGCCCTTCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks