EMAIL THIS PAGE TO A FRIEND

SPINK9

serine peptidase inhibitor, Kazal type 9

Synonyms: LEKTI2
UniProtKB ID: Q5DT21, B2RPN9
Gene ID:
dog(100685551) serine peptidase inhibitor, Kazal type 9
domestic cat(101087814) serine peptidase inhibitor, Kazal type 9
cow(100297800) serine peptidase inhibitor, Kazal type 9
sheep(101109177) serine peptidase inhibitor, Kazal type 9
domestic guinea pig(101788317) serine peptidase inhibitor, Kazal type 9
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040433 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102361 MISSION® esiRNA esiRNA human SPINK9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040433 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196992 predicted 205
2 SASI_Hs01_00196993 predicted 208
3 SASI_Hs01_00196994 predicted 202
4 SASI_Hs01_00196995 predicted 400
5 SASI_Hs01_00196996 predicted 138
6 SASI_Hs02_00308960 predicted 68
7 SASI_Hs01_00196997 predicted 139
8 SASI_Hs02_00308961 predicted 57
9 SASI_Hs01_00197000 predicted 99
10 SASI_Hs02_00308962 predicted 87
11 SASI_Hs01_00196991 predicted 217
12 SASI_Hs01_00196998 predicted 362
13 SASI_Hs01_00196999 predicted 143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040433
SPINK9 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kazal type 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-275s21c1
Sequence:CCGGACTGACGGCACACTTAAATTTCTCGAGAAATTTAAGTGTGCCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-96s21c1
Sequence:CCGGTTGCAACCATGTTCAGTATAGCTCGAGCTATACTGAACATGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-245s21c1
Sequence:CCGGGATTGCTTCTTCTGTTCTAAACTCGAGTTTAGAACAGAAGAAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-118s21c1
Sequence:CCGGATGTGCCAAACAGACGAAACACTCGAGTGTTTCGTCTGTTTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-143s21c1
Sequence:CCGGGTTGACTGCAGTCATTATAAACTCGAGTTTATAATGACTGCAGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040433
SPINK9 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kazal type 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-275s21c1
Sequence:CCGGACTGACGGCACACTTAAATTTCTCGAGAAATTTAAGTGTGCCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-96s21c1
Sequence:CCGGTTGCAACCATGTTCAGTATAGCTCGAGCTATACTGAACATGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-245s21c1
Sequence:CCGGGATTGCTTCTTCTGTTCTAAACTCGAGTTTAGAACAGAAGAAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-118s21c1
Sequence:CCGGATGTGCCAAACAGACGAAACACTCGAGTGTTTCGTCTGTTTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-143s21c1
Sequence:CCGGGTTGACTGCAGTCATTATAAACTCGAGTTTATAATGACTGCAGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040433
SPINK9 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kazal type 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-275s21c1
Sequence:CCGGACTGACGGCACACTTAAATTTCTCGAGAAATTTAAGTGTGCCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-96s21c1
Sequence:CCGGTTGCAACCATGTTCAGTATAGCTCGAGCTATACTGAACATGGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-245s21c1
Sequence:CCGGGATTGCTTCTTCTGTTCTAAACTCGAGTTTAGAACAGAAGAAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-118s21c1
Sequence:CCGGATGTGCCAAACAGACGAAACACTCGAGTGTTTCGTCTGTTTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040433.1-143s21c1
Sequence:CCGGGTTGACTGCAGTCATTATAAACTCGAGTTTATAATGACTGCAGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks