EMAIL THIS PAGE TO A FRIEND

SPINT1

serine peptidase inhibitor, Kunitz type 1

Synonyms: HAI HAI1 MANSC2
UniProtKB ID: O43278, Q7Z7D2
Gene ID:
Human(6692) Summary: The protein encoded by this gene is a member of the Kunitz family of serine protease inhibitors. The protein is a potent inhibitor specific for HGF activator and is thought to be involved in the regulation of the proteolytic activation of HGF in injured tissues. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(20732) serine protease inhibitor, Kunitz type 1
Rat(311331) serine peptidase inhibitor, Kunitz type 1
cow(534040) serine peptidase inhibitor, Kunitz type 1
sheep(101111287) serine peptidase inhibitor, Kunitz type 1
domestic guinea pig(100731222) serine peptidase inhibitor, Kunitz type 1
naked mole-rat(101720247) serine peptidase inhibitor, Kunitz type 1
Domestic Rabbit(100345098) serine peptidase inhibitor, Kunitz type 1
chicken(423206) serine peptidase inhibitor, Kunitz type 1
domestic cat(101085636) serine peptidase inhibitor, Kunitz type 1
dog(487501) serine peptidase inhibitor, Kunitz type 1
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032367 Rosetta Predictions human pricing
NM_003710 Rosetta Predictions human pricing
NM_181642 Rosetta Predictions human pricing
NM_001004265 Rosetta Predictions rat pricing
NM_016907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164196 predicted 2051
2 SASI_Hs01_00164197 predicted 1310
3 SASI_Hs02_00307906 predicted 1324
4 SASI_Hs01_00164198 predicted 2059
5 SASI_Hs01_00164199 predicted 795
6 SASI_Hs01_00164200 predicted 757
7 SASI_Hs01_00164201 predicted 1798
8 SASI_Hs01_00164202 predicted 1295
9 SASI_Hs01_00164204 predicted 796
10 SASI_Hs02_00307907 predicted 1297
11 SASI_Hs01_00164203 predicted 1322
12 SASI_Hs01_00164205 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175026 predicted 2147
2 SASI_Hs01_00175027 predicted 1401
3 SASI_Hs02_00336129 predicted 1419
4 SASI_Hs01_00175028 predicted 2149
5 SASI_Hs01_00175029 predicted 893
6 SASI_Hs01_00175030 predicted 846
7 SASI_Hs01_00175031 predicted 1894
8 SASI_Hs01_00175032 predicted 1394
9 SASI_Hs01_00175034 predicted 892
10 SASI_Hs02_00336130 predicted 1384
11 SASI_Hs01_00175033 predicted 1424
12 SASI_Hs01_00175035 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149584 predicted 2190
2 SASI_Hs01_00149585 predicted 1451
3 SASI_Hs02_00370210 predicted 1462
4 SASI_Hs01_00149586 predicted 2206
5 SASI_Hs01_00149587 predicted 894
6 SASI_Hs01_00149588 predicted 852
7 SASI_Hs01_00149589 predicted 1946
8 SASI_Hs01_00149590 predicted 1435
9 SASI_Hs01_00149592 predicted 888
10 SASI_Hs02_00370211 predicted 1438
11 SASI_Hs01_00149591 predicted 1470
12 SASI_Hs01_00149593 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104237 predicted 1298
2 SASI_Rn01_00104238 predicted 1292
3 SASI_Rn02_00198286 predicted 1281
4 SASI_Rn01_00104239 predicted 619
5 SASI_Rn01_00104240 predicted 1430
6 SASI_Rn01_00104242 predicted 1850
7 SASI_Rn01_00104243 predicted 1108
8 SASI_Rn01_00104244 predicted 835
9 SASI_Rn01_00104245 predicted 613
10 SASI_Rn01_00104246 predicted 1449
11 SASI_Rn01_00104241 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323759 predicted 597
2 SASI_Mm01_00191690 predicted 1261
3 SASI_Mm01_00191691 predicted 884
4 SASI_Mm01_00191693 predicted 1038
5 SASI_Mm01_00191694 predicted 1389
6 SASI_Mm01_00191695 predicted 1333
7 SASI_Mm01_00191696 predicted 1802
8 SASI_Mm01_00191697 predicted 910
9 SASI_Mm01_00191698 predicted 666
10 SASI_Mm01_00191699 predicted 1528
11 SASI_Mm01_00191692 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016907
SPINT1 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kunitz type 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016907.2-2121s1c1
Sequence:CCGGCCTGCTTTCTTATAGAACCAACTCGAGTTGGTTCTATAAGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-987s1c1
Sequence:CCGGCCTGGGCAACAAGAACAACTACTCGAGTAGTTGTTCTTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-946s1c1
Sequence:CCGGCCCAAGGAACAGATCTGCAAACTCGAGTTTGCAGATCTGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-1511s1c1
Sequence:CCGGTCTGCATCATAGTGGTCTTAACTCGAGTTAAGACCACTATGATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-866s1c1
Sequence:CCGGCCAAGCAGACAGAAGATTATTCTCGAGAATAATCTTCTGTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016907
SPINT1 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kunitz type 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016907.2-2121s1c1
Sequence:CCGGCCTGCTTTCTTATAGAACCAACTCGAGTTGGTTCTATAAGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-987s1c1
Sequence:CCGGCCTGGGCAACAAGAACAACTACTCGAGTAGTTGTTCTTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-946s1c1
Sequence:CCGGCCCAAGGAACAGATCTGCAAACTCGAGTTTGCAGATCTGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-1511s1c1
Sequence:CCGGTCTGCATCATAGTGGTCTTAACTCGAGTTAAGACCACTATGATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-866s1c1
Sequence:CCGGCCAAGCAGACAGAAGATTATTCTCGAGAATAATCTTCTGTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016907
SPINT1 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kunitz type 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016907.2-2121s1c1
Sequence:CCGGCCTGCTTTCTTATAGAACCAACTCGAGTTGGTTCTATAAGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-987s1c1
Sequence:CCGGCCTGGGCAACAAGAACAACTACTCGAGTAGTTGTTCTTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-946s1c1
Sequence:CCGGCCCAAGGAACAGATCTGCAAACTCGAGTTTGCAGATCTGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-1511s1c1
Sequence:CCGGTCTGCATCATAGTGGTCTTAACTCGAGTTAAGACCACTATGATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016907.2-866s1c1
Sequence:CCGGCCAAGCAGACAGAAGATTATTCTCGAGAATAATCTTCTGTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003710
SPINT1 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kunitz type 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1414s1c1
Sequence:CCGGCTTTACCTATGGTGGTTGTTACTCGAGTAACAACCACCATAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1082s1c1
Sequence:CCGGCGGGAAGAAGAGTGCATTCTACTCGAGTAGAATGCACTCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1079s1c1
Sequence:CCGGCTTCGGGAAGAAGAGTGCATTCTCGAGAATGCACTCTTCTTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1413s1c1
Sequence:CCGGGCTTTACCTATGGTGGTTGTTCTCGAGAACAACCACCATAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003710.2-2163s1c1
Sequence:CCGGCCTGTGTAGTTTGTGCTGTAACTCGAGTTACAGCACAAACTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003710
SPINT1 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kunitz type 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1414s1c1
Sequence:CCGGCTTTACCTATGGTGGTTGTTACTCGAGTAACAACCACCATAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1082s1c1
Sequence:CCGGCGGGAAGAAGAGTGCATTCTACTCGAGTAGAATGCACTCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1079s1c1
Sequence:CCGGCTTCGGGAAGAAGAGTGCATTCTCGAGAATGCACTCTTCTTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1413s1c1
Sequence:CCGGGCTTTACCTATGGTGGTTGTTCTCGAGAACAACCACCATAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003710.2-2163s1c1
Sequence:CCGGCCTGTGTAGTTTGTGCTGTAACTCGAGTTACAGCACAAACTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003710
SPINT1 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kunitz type 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1414s1c1
Sequence:CCGGCTTTACCTATGGTGGTTGTTACTCGAGTAACAACCACCATAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1082s1c1
Sequence:CCGGCGGGAAGAAGAGTGCATTCTACTCGAGTAGAATGCACTCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1079s1c1
Sequence:CCGGCTTCGGGAAGAAGAGTGCATTCTCGAGAATGCACTCTTCTTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003710.2-1413s1c1
Sequence:CCGGGCTTTACCTATGGTGGTTGTTCTCGAGAACAACCACCATAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003710.2-2163s1c1
Sequence:CCGGCCTGTGTAGTTTGTGCTGTAACTCGAGTTACAGCACAAACTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks