EMAIL THIS PAGE TO A FRIEND

SPINT2

serine peptidase inhibitor, Kunitz type, 2

Synonyms: DIAR3 HAI-2 HAI2 Kop PB
Gene ID:
Human(10653) Summary: This gene encodes a transmembrane protein with two extracellular Kunitz domains that inhibits a variety of serine proteases. The protein inhibits HGF activator which prevents the formation of active hepatocyte growth factor. This gene is a putative tumor suppressor, and mutations in this gene result in congenital sodium diarrhea. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(20733) serine protease inhibitor, Kunitz type 2
Rat(292770) serine peptidase inhibitor, Kunitz type, 2
Zebrafish(562009) serine peptidase inhibitor, Kunitz type, 2
dog(403665) serine peptidase inhibitor, Kunitz type, 2
domestic cat(101101682) serine peptidase inhibitor, Kunitz type, 2
naked mole-rat(101704151) serine peptidase inhibitor, Kunitz type, 2
domestic guinea pig(100726185) serine peptidase inhibitor, Kunitz type, 2
cow(507484) serine peptidase inhibitor, Kunitz type, 2
sheep(101110167) serine peptidase inhibitor, Kunitz type, 2
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0673 Human SPINT2 / Kunitz-type Protease Inhibitor 2 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021102 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021102 Rosetta Predictions human pricing
NM_001082549 Rosetta Predictions rat pricing
NM_199087 Rosetta Predictions rat pricing
NM_001082548 Rosetta Predictions mouse pricing
NM_011464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168900 predicted 1161
2 SASI_Hs01_00168901 predicted 646
3 SASI_Hs01_00168902 predicted 501
4 SASI_Hs01_00168903 predicted 550
5 SASI_Hs01_00168905 predicted 665
6 SASI_Hs01_00168906 predicted 536
7 SASI_Hs01_00168907 predicted 639
8 SASI_Hs01_00168908 predicted 698
9 SASI_Hs01_00168909 predicted 1160
10 SASI_Hs02_00354589 predicted 782
11 SASI_Hs01_00168904 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208779 predicted 1098
2 SASI_Rn02_00208780 predicted 773
3 SASI_Rn02_00208781 predicted 827
4 SASI_Rn02_00208782 predicted 1075
5 SASI_Rn02_00208783 predicted 1064
6 SASI_Rn02_00208784 predicted 782
7 SASI_Rn02_00208785 predicted 931
8 SASI_Rn02_00208786 predicted 1065
9 SASI_Rn02_00208787 predicted 1080
10 SASI_Rn02_00208788 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270091 predicted 932
2 SASI_Rn01_00085126 predicted 603
3 SASI_Rn02_00270092 predicted 656
4 SASI_Rn01_00085127 predicted 909
5 SASI_Rn01_00085129 predicted 896
6 SASI_Rn01_00085130 predicted 619
7 SASI_Rn01_00085131 predicted 759
8 SASI_Rn02_00270093 predicted 888
9 SASI_Rn02_00270094 predicted 906
10 SASI_Rn01_00085133 predicted 919
11 SASI_Rn01_00085125 predicted 426
12 SASI_Rn01_00085128 predicted 333
13 SASI_Rn01_00085132 predicted 553
14 SASI_Rn01_00085134 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299345 predicted 970
2 SASI_Mm02_00299346 predicted 685
3 SASI_Mm02_00299347 predicted 695
4 SASI_Mm02_00299348 predicted 740
5 SASI_Mm02_00299349 predicted 737
6 SASI_Mm02_00299350 predicted 953
7 SASI_Mm02_00299351 predicted 822
8 SASI_Mm02_00299352 predicted 797
9 SASI_Mm02_00299353 predicted 825
10 SASI_Mm02_00299354 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320723 predicted 1141
2 SASI_Mm01_00051109 predicted 855
3 SASI_Mm01_00051112 predicted 869
4 SASI_Mm01_00051108 predicted 909
5 SASI_Mm01_00051111 predicted 905
6 SASI_Mm02_00320724 predicted 1130
7 SASI_Mm02_00320725 predicted 991
8 SASI_Mm02_00320726 predicted 968
9 SASI_Mm02_00320727 predicted 1003
10 SASI_Mm02_00320728 predicted 1138
11 SASI_Mm01_00051103 predicted 507
12 SASI_Mm01_00051104 predicted 1066
13 SASI_Mm01_00051105 predicted 723
14 SASI_Mm01_00051106 predicted 1065
15 SASI_Mm01_00051107 predicted 578
16 SASI_Mm01_00051110 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011464
VALIDATED
SPINT2 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kunitz type, 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-736s1c1
Sequence:CCGGGCTGGTACTATGACACTGAAACTCGAGTTTCAGTGTCATAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-1031s1c1
Sequence:CCGGGAAGAACACCTGTGTCTTGTACTCGAGTACAAGACACAGGTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-1075s1c1
Sequence:CCGGGAGTACAACTTGTGCTGTTTACTCGAGTAAACAGCACAAGTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011464.1-453s1c1
Sequence:CCGGTGGTGGTACAATATCACTGATCTCGAGATCAGTGATATTGTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-902s1c1
Sequence:CCGGGCTGTTCCTCATGGTTCTGATCTCGAGATCAGAACCATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011464.2-571s21c1
Sequence:CCGGTGTGAAGGCAATGGCAATAACCTCGAGGTTATTGCCATTGCCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-1177s21c1
Sequence:CCGGTGCTTGCGTCTGAGATCATTACTCGAGTAATGATCTCAGACGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011464.2-1098s21c1
Sequence:CCGGGAAGAACACCTGTGTCTTGTACTCGAGTACAAGACACAGGTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-803s21c1
Sequence:CCGGGCTGGTACTATGACACTGAAACTCGAGTTTCAGTGTCATAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-1021s21c1
Sequence:CCGGATCCGTGTGGTTCGCAGAAAGCTCGAGCTTTCTGCGAACCACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-969s21c1
Sequence:CCGGGCTGTTCCTCATGGTTCTGATCTCGAGATCAGAACCATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011464
VALIDATED
SPINT2 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kunitz type, 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-736s1c1
Sequence:CCGGGCTGGTACTATGACACTGAAACTCGAGTTTCAGTGTCATAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-1031s1c1
Sequence:CCGGGAAGAACACCTGTGTCTTGTACTCGAGTACAAGACACAGGTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-1075s1c1
Sequence:CCGGGAGTACAACTTGTGCTGTTTACTCGAGTAAACAGCACAAGTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011464.1-453s1c1
Sequence:CCGGTGGTGGTACAATATCACTGATCTCGAGATCAGTGATATTGTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-902s1c1
Sequence:CCGGGCTGTTCCTCATGGTTCTGATCTCGAGATCAGAACCATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011464.2-571s21c1
Sequence:CCGGTGTGAAGGCAATGGCAATAACCTCGAGGTTATTGCCATTGCCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-1177s21c1
Sequence:CCGGTGCTTGCGTCTGAGATCATTACTCGAGTAATGATCTCAGACGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011464.2-1098s21c1
Sequence:CCGGGAAGAACACCTGTGTCTTGTACTCGAGTACAAGACACAGGTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-803s21c1
Sequence:CCGGGCTGGTACTATGACACTGAAACTCGAGTTTCAGTGTCATAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-1021s21c1
Sequence:CCGGATCCGTGTGGTTCGCAGAAAGCTCGAGCTTTCTGCGAACCACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-969s21c1
Sequence:CCGGGCTGTTCCTCATGGTTCTGATCTCGAGATCAGAACCATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011464
VALIDATED
SPINT2 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kunitz type, 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-736s1c1
Sequence:CCGGGCTGGTACTATGACACTGAAACTCGAGTTTCAGTGTCATAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-1031s1c1
Sequence:CCGGGAAGAACACCTGTGTCTTGTACTCGAGTACAAGACACAGGTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-1075s1c1
Sequence:CCGGGAGTACAACTTGTGCTGTTTACTCGAGTAAACAGCACAAGTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011464.1-453s1c1
Sequence:CCGGTGGTGGTACAATATCACTGATCTCGAGATCAGTGATATTGTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011464.1-902s1c1
Sequence:CCGGGCTGTTCCTCATGGTTCTGATCTCGAGATCAGAACCATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011464.2-571s21c1
Sequence:CCGGTGTGAAGGCAATGGCAATAACCTCGAGGTTATTGCCATTGCCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-1177s21c1
Sequence:CCGGTGCTTGCGTCTGAGATCATTACTCGAGTAATGATCTCAGACGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011464.2-1098s21c1
Sequence:CCGGGAAGAACACCTGTGTCTTGTACTCGAGTACAAGACACAGGTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-803s21c1
Sequence:CCGGGCTGGTACTATGACACTGAAACTCGAGTTTCAGTGTCATAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-1021s21c1
Sequence:CCGGATCCGTGTGGTTCGCAGAAAGCTCGAGCTTTCTGCGAACCACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011464.2-969s21c1
Sequence:CCGGGCTGTTCCTCATGGTTCTGATCTCGAGATCAGAACCATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021102
VALIDATED
SPINT2 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kunitz type, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-768s1c1
Sequence:CCGGCTCCTGCAATAACTTCATCTACTCGAGTAGATGAAGTTATTGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-512s1c1
Sequence:CCGGGTGACGGAAACAGCAATAATTCTCGAGAATTATTGCTGTTTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-602s1c1
Sequence:CCGGCCAGCAGGAATGCAGCGGATTCTCGAGAATCCGCTGCATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-1030s1c1
Sequence:CCGGCAGCTGGTGAAGAACACATATCTCGAGATATGTGTTCTTCACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-666s1c1
Sequence:CCGGCTCCAGCGATATGTTCAACTACTCGAGTAGTTGAACATATCGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-633s21c1
Sequence:CCGGCCAGCAGGAATGCAGCGGATTCTCGAGAATCCGCTGCATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-799s21c1
Sequence:CCGGCTCCTGCAATAACTTCATCTACTCGAGTAGATGAAGTTATTGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-543s21c1
Sequence:CCGGGTGACGGAAACAGCAATAATTCTCGAGAATTATTGCTGTTTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-697s21c1
Sequence:CCGGCTCCAGCGATATGTTCAACTACTCGAGTAGTTGAACATATCGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-1061s21c1
Sequence:CCGGCAGCTGGTGAAGAACACATATCTCGAGATATGTGTTCTTCACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021102
VALIDATED
SPINT2 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kunitz type, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-768s1c1
Sequence:CCGGCTCCTGCAATAACTTCATCTACTCGAGTAGATGAAGTTATTGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-512s1c1
Sequence:CCGGGTGACGGAAACAGCAATAATTCTCGAGAATTATTGCTGTTTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-602s1c1
Sequence:CCGGCCAGCAGGAATGCAGCGGATTCTCGAGAATCCGCTGCATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-1030s1c1
Sequence:CCGGCAGCTGGTGAAGAACACATATCTCGAGATATGTGTTCTTCACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-666s1c1
Sequence:CCGGCTCCAGCGATATGTTCAACTACTCGAGTAGTTGAACATATCGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-633s21c1
Sequence:CCGGCCAGCAGGAATGCAGCGGATTCTCGAGAATCCGCTGCATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-799s21c1
Sequence:CCGGCTCCTGCAATAACTTCATCTACTCGAGTAGATGAAGTTATTGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-543s21c1
Sequence:CCGGGTGACGGAAACAGCAATAATTCTCGAGAATTATTGCTGTTTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-697s21c1
Sequence:CCGGCTCCAGCGATATGTTCAACTACTCGAGTAGTTGAACATATCGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-1061s21c1
Sequence:CCGGCAGCTGGTGAAGAACACATATCTCGAGATATGTGTTCTTCACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021102
VALIDATED
SPINT2 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kunitz type, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-768s1c1
Sequence:CCGGCTCCTGCAATAACTTCATCTACTCGAGTAGATGAAGTTATTGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-512s1c1
Sequence:CCGGGTGACGGAAACAGCAATAATTCTCGAGAATTATTGCTGTTTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-602s1c1
Sequence:CCGGCCAGCAGGAATGCAGCGGATTCTCGAGAATCCGCTGCATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-1030s1c1
Sequence:CCGGCAGCTGGTGAAGAACACATATCTCGAGATATGTGTTCTTCACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021102.1-666s1c1
Sequence:CCGGCTCCAGCGATATGTTCAACTACTCGAGTAGTTGAACATATCGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-633s21c1
Sequence:CCGGCCAGCAGGAATGCAGCGGATTCTCGAGAATCCGCTGCATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-799s21c1
Sequence:CCGGCTCCTGCAATAACTTCATCTACTCGAGTAGATGAAGTTATTGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-543s21c1
Sequence:CCGGGTGACGGAAACAGCAATAATTCTCGAGAATTATTGCTGTTTCCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-697s21c1
Sequence:CCGGCTCCAGCGATATGTTCAACTACTCGAGTAGTTGAACATATCGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021102.2-1061s21c1
Sequence:CCGGCAGCTGGTGAAGAACACATATCTCGAGATATGTGTTCTTCACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks