EMAIL THIS PAGE TO A FRIEND

SPINT3

serine peptidase inhibitor, Kunitz type, 3

Synonyms: HKIB9
UniProtKB ID: P49223, A6NCQ6, Q6UDR8, Q96KK2
Gene ID:
Mouse(629747) serine peptidase inhibitor, Kunitz type, 3
Rat(685136) serine peptidase inhibitor, Kunitz type, 3
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006652 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU161891 MISSION® esiRNA esiRNA targeting mouse Spint3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006652 Rosetta Predictions human pricing
XM_001062494 Rosetta Predictions rat pricing
XM_894671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342022 predicted 104
2 SASI_Hs02_00342023 predicted 256
3 SASI_Hs02_00342024 predicted 85
4 SASI_Hs02_00342025 predicted 58
5 SASI_Hs02_00342026 predicted 63
6 SASI_Hs02_00342027 predicted 298
7 SASI_Hs02_00342028 predicted 100
8 SASI_Hs02_00342029 predicted 154
9 SASI_Hs02_00342030 predicted 54
10 SASI_Hs02_00342031 predicted 70
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303657 predicted 200
2 SASI_Rn02_00303658 predicted 197
3 SASI_Rn02_00303659 predicted 204
4 SASI_Rn02_00303660 predicted 377
5 SASI_Rn02_00303661 predicted 113
6 SASI_Rn02_00303662 predicted 103
7 SASI_Rn02_00303663 predicted 129
8 SASI_Rn02_00303664 predicted 147
9 SASI_Rn02_00303665 predicted 237
10 SASI_Rn02_00303666 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236342 predicted 265
2 SASI_Mm01_00236343 predicted 279
3 SASI_Mm02_00429544 predicted 254
4 SASI_Mm01_00236346 predicted 232
5 SASI_Mm01_00236347 predicted 213
6 SASI_Mm01_00236348 predicted 249
7 SASI_Mm01_00236349 predicted 255
8 SASI_Mm01_00236350 predicted 264
9 SASI_Mm02_00429545 predicted 213
10 SASI_Mm01_00236351 predicted 228
11 SASI_Mm01_00236344 predicted 280
12 SASI_Mm01_00236345 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006652
SPINT3 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kunitz type, 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-80s21c1
Sequence:CCGGGAACTAGCACGAGACACTATCCTCGAGGATAGTGTCTCGTGCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006652.1-298s21c1
Sequence:CCGGGAACACAGCCCTCCATGGATTCTCGAGAATCCATGGAGGGCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-144s21c1
Sequence:CCGGGCCCTTGTCAAACCTACATGACTCGAGTCATGTAGGTTTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-109s21c1
Sequence:CCGGCCTCCCAAATGTATGCGCTTTCTCGAGAAAGCGCATACATTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-188s21c1
Sequence:CCGGACTGGTGAATGTGAGTTATTTCTCGAGAAATAACTCACATTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006652
SPINT3 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kunitz type, 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-80s21c1
Sequence:CCGGGAACTAGCACGAGACACTATCCTCGAGGATAGTGTCTCGTGCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006652.1-298s21c1
Sequence:CCGGGAACACAGCCCTCCATGGATTCTCGAGAATCCATGGAGGGCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-144s21c1
Sequence:CCGGGCCCTTGTCAAACCTACATGACTCGAGTCATGTAGGTTTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-109s21c1
Sequence:CCGGCCTCCCAAATGTATGCGCTTTCTCGAGAAAGCGCATACATTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-188s21c1
Sequence:CCGGACTGGTGAATGTGAGTTATTTCTCGAGAAATAACTCACATTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006652
SPINT3 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kunitz type, 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-80s21c1
Sequence:CCGGGAACTAGCACGAGACACTATCCTCGAGGATAGTGTCTCGTGCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006652.1-298s21c1
Sequence:CCGGGAACACAGCCCTCCATGGATTCTCGAGAATCCATGGAGGGCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-144s21c1
Sequence:CCGGGCCCTTGTCAAACCTACATGACTCGAGTCATGTAGGTTTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-109s21c1
Sequence:CCGGCCTCCCAAATGTATGCGCTTTCTCGAGAAAGCGCATACATTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006652.1-188s21c1
Sequence:CCGGACTGGTGAATGTGAGTTATTTCTCGAGAAATAACTCACATTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks