EMAIL THIS PAGE TO A FRIEND

SPINT4

serine peptidase inhibitor, Kunitz type 4

Synonyms: C20orf137 SPINT3 dJ601O1.1
UniProtKB ID: Q6UDR6, Q9BQN3
Gene ID:
Mouse(78239) serine protease inhibitor, Kunitz type 4
Rat(100361889) serine peptidase inhibitor, Kunitz type 4
dog(100686098) serine peptidase inhibitor, Kunitz type 4
domestic guinea pig(100726827) serine peptidase inhibitor, Kunitz type 4
naked mole-rat(101704144) serine peptidase inhibitor, Kunitz type 4
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178455 Rosetta Predictions human pricing
XM_372869 Rosetta Predictions human pricing
NM_030058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369684 predicted 305
2 SASI_Hs02_00369685 predicted 321
3 SASI_Hs02_00369686 predicted 160
4 SASI_Hs02_00369687 predicted 169
5 SASI_Hs02_00369688 predicted 310
6 SASI_Hs02_00369689 predicted 118
7 SASI_Hs02_00369690 predicted 339
8 SASI_Hs02_00369691 predicted 311
9 SASI_Hs02_00369692 predicted 160
10 SASI_Hs02_00369693 predicted 63
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268886 predicted 278
2 SASI_Hs01_00268887 predicted 279
3 SASI_Hs01_00268888 predicted 247
4 SASI_Hs01_00268889 predicted 266
5 SASI_Hs01_00268890 predicted 233
6 SASI_Hs01_00268891 predicted 275
7 SASI_Hs01_00268892 predicted 230
8 SASI_Hs01_00268893 predicted 272
9 SASI_Hs01_00268894 predicted 229
10 SASI_Hs01_00268895 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035745 predicted 386
2 SASI_Mm01_00035746 predicted 309
3 SASI_Mm01_00035747 predicted 351
4 SASI_Mm01_00035748 predicted 259
5 SASI_Mm01_00035749 predicted 423
6 SASI_Mm01_00035751 predicted 348
7 SASI_Mm01_00035752 predicted 517
8 SASI_Mm01_00035753 predicted 233
9 SASI_Mm02_00336423 predicted 410
10 SASI_Mm02_00336424 predicted 369
11 SASI_Mm01_00035750 predicted 230
12 SASI_Mm01_00035754 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178455
SPINT4 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kunitz type 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-173s21c1
Sequence:CCGGGAAGTTCACTTTAGATATTTCCTCGAGGAAATATCTAAAGTGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-114s21c1
Sequence:CCGGAGATATGTGGAGACCTCAAAGCTCGAGCTTTGAGGTCTCCACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-126s21c1
Sequence:CCGGACCTCAAAGATCCCTGCAAATCTCGAGATTTGCAGGGATCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-66s21c1
Sequence:CCGGGCTCATTGAATACCCTGTTATCTCGAGATAACAGGGTATTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-81s21c1
Sequence:CCGGTGTTATTGGGTGGTGTTAATACTCGAGTATTAACACCACCCAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178455
SPINT4 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kunitz type 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-173s21c1
Sequence:CCGGGAAGTTCACTTTAGATATTTCCTCGAGGAAATATCTAAAGTGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-114s21c1
Sequence:CCGGAGATATGTGGAGACCTCAAAGCTCGAGCTTTGAGGTCTCCACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-126s21c1
Sequence:CCGGACCTCAAAGATCCCTGCAAATCTCGAGATTTGCAGGGATCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-66s21c1
Sequence:CCGGGCTCATTGAATACCCTGTTATCTCGAGATAACAGGGTATTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-81s21c1
Sequence:CCGGTGTTATTGGGTGGTGTTAATACTCGAGTATTAACACCACCCAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178455
SPINT4 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kunitz type 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-173s21c1
Sequence:CCGGGAAGTTCACTTTAGATATTTCCTCGAGGAAATATCTAAAGTGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-114s21c1
Sequence:CCGGAGATATGTGGAGACCTCAAAGCTCGAGCTTTGAGGTCTCCACATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-126s21c1
Sequence:CCGGACCTCAAAGATCCCTGCAAATCTCGAGATTTGCAGGGATCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-66s21c1
Sequence:CCGGGCTCATTGAATACCCTGTTATCTCGAGATAACAGGGTATTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178455.1-81s21c1
Sequence:CCGGTGTTATTGGGTGGTGTTAATACTCGAGTATTAACACCACCCAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030058
SPINT4 MISSION shRNA Bacterial Glycerol Stock
serine peptidase inhibitor, Kunitz type 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030058.1-609s1c1
Sequence:CCGGGCCATCTGAAATAAAGATTCACTCGAGTGAATCTTTATTTCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-394s1c1
Sequence:CCGGCCAAGAACCTTGCTACGGATTCTCGAGAATCCGTAGCAAGGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-372s1c1
Sequence:CCGGCGTTCTCTAAGAGCATTGGCACTCGAGTGCCAATGCTCTTAGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-134s1c1
Sequence:CCGGGCTAGCTAACTATCTCTGCAACTCGAGTTGCAGAGATAGTTAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-281s1c1
Sequence:CCGGCCTTAATAACTTCAAGCTGAACTCGAGTTCAGCTTGAAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030058
SPINT4 MISSION shRNA shRNA Plasmid DNA
serine peptidase inhibitor, Kunitz type 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030058.1-609s1c1
Sequence:CCGGGCCATCTGAAATAAAGATTCACTCGAGTGAATCTTTATTTCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-394s1c1
Sequence:CCGGCCAAGAACCTTGCTACGGATTCTCGAGAATCCGTAGCAAGGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-372s1c1
Sequence:CCGGCGTTCTCTAAGAGCATTGGCACTCGAGTGCCAATGCTCTTAGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-134s1c1
Sequence:CCGGGCTAGCTAACTATCTCTGCAACTCGAGTTGCAGAGATAGTTAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-281s1c1
Sequence:CCGGCCTTAATAACTTCAAGCTGAACTCGAGTTCAGCTTGAAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030058
SPINT4 MISSION shRNA Lentiviral Transduction Particles
serine peptidase inhibitor, Kunitz type 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030058.1-609s1c1
Sequence:CCGGGCCATCTGAAATAAAGATTCACTCGAGTGAATCTTTATTTCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-394s1c1
Sequence:CCGGCCAAGAACCTTGCTACGGATTCTCGAGAATCCGTAGCAAGGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-372s1c1
Sequence:CCGGCGTTCTCTAAGAGCATTGGCACTCGAGTGCCAATGCTCTTAGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-134s1c1
Sequence:CCGGGCTAGCTAACTATCTCTGCAACTCGAGTTGCAGAGATAGTTAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030058.1-281s1c1
Sequence:CCGGCCTTAATAACTTCAAGCTGAACTCGAGTTCAGCTTGAAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks