EMAIL THIS PAGE TO A FRIEND

SPIRE1

spire-type actin nucleation factor 1

Synonyms: Spir-1
Gene ID:
Human(56907) Summary: Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]
Mouse(68166) spire homolog 1 (Drosophila)
Rat(307348) spire homolog 1 (Drosophila)
cow(519030) spire homolog 1 (Drosophila)
sheep(101106482) spire homolog 1 (Drosophila)
Goat(100861014) spire homolog 1 (Drosophila)
domestic guinea pig(100732641) spire homolog 1 (Drosophila)
naked mole-rat(101722680) spire homolog 1 (Drosophila)
chicken(421033) spire homolog 1 (Drosophila)
dog(490562) spire homolog 1 (Drosophila)
domestic cat(101097181) spire homolog 1 (Drosophila)
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020148 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020148 Rosetta Predictions human pricing
NM_001107381 Rosetta Predictions rat pricing
NM_176832 Rosetta Predictions mouse pricing
NM_194355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089950 predicted 916
2 SASI_Hs01_00089951 predicted 2370
3 SASI_Hs01_00089952 predicted 728
4 SASI_Hs01_00089953 predicted 1586
5 SASI_Hs01_00089954 predicted 624
6 SASI_Hs02_00353040 predicted 698
7 SASI_Hs01_00089956 predicted 723
8 SASI_Hs01_00089957 predicted 1749
9 SASI_Hs01_00089958 predicted 1283
10 SASI_Hs01_00089959 predicted 547
11 SASI_Hs01_00089955 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228265 predicted 618
2 SASI_Rn02_00228266 predicted 517
3 SASI_Rn02_00228267 predicted 846
4 SASI_Rn02_00228268 predicted 1966
5 SASI_Rn02_00228269 predicted 663
6 SASI_Rn02_00228270 predicted 572
7 SASI_Rn02_00228271 predicted 608
8 SASI_Rn02_00228272 predicted 760
9 SASI_Rn02_00228273 predicted 530
10 SASI_Rn02_00228274 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111093 predicted 359
2 SASI_Mm01_00111094 predicted 688
3 SASI_Mm01_00111095 predicted 1937
4 SASI_Mm01_00111096 predicted 266
5 SASI_Mm01_00111097 predicted 1294
6 SASI_Mm01_00111098 predicted 1912
7 SASI_Mm02_00346719 predicted 1912
8 SASI_Mm01_00111100 predicted 454
9 SASI_Mm01_00111101 predicted 654
10 SASI_Mm01_00111102 predicted 684
11 SASI_Mm01_00111099 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087712 predicted 456
2 SASI_Mm01_00087713 predicted 785
3 SASI_Mm01_00087714 predicted 2210
4 SASI_Mm01_00087715 predicted 366
5 SASI_Mm01_00087716 predicted 1572
6 SASI_Mm01_00087717 predicted 2180
7 SASI_Mm02_00350635 predicted 2180
8 SASI_Mm01_00087719 predicted 553
9 SASI_Mm01_00087720 predicted 752
10 SASI_Mm01_00087721 predicted 782
11 SASI_Mm01_00087718 predicted 2205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020148
VALIDATED
SPIRE1 MISSION shRNA Bacterial Glycerol Stock
spire-type actin nucleation factor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-672s21c1
Sequence:CCGGACTGAATCAGATGCACCAAATCTCGAGATTTGGTGCATCTGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1683s21c1
Sequence:CCGGGTGGAAGAAGTGATGCATATTCTCGAGAATATGCATCACTTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-2120s21c1
Sequence:CCGGCAAGAAGTTCATTTCGGAAATCTCGAGATTTCCGAAATGAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-615s21c1
Sequence:CCGGATCTCAGCTATTCGGTCATATCTCGAGATATGACCGAATAGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020148.2-2567s1c1
Sequence:CCGGCTTTACTGTTCCTCGAATAATCTCGAGATTATTCGAGGAACAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.2-380s1c1
Sequence:CCGGTGCGGGTAAATTGGGATATTCCTCGAGGAATATCCCAATTTACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1015s21c1
Sequence:CCGGTGATGGTGAATGGTGATATTCCTCGAGGAATATCACCATTCACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1661s21c1
Sequence:CCGGAGTGGAATGCCTCGCTCTTACCTCGAGGTAAGAGCGAGGCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.1-845s1c1
Sequence:CCGGCAAAGAATCTTGTGGAGTCATCTCGAGATGACTCCACAAGATTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020148.1-1540s1c1
Sequence:CCGGGAAAGTAGTATGAGGTCAGAACTCGAGTTCTGACCTCATACTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.1-553s1c1
Sequence:CCGGGAGATGTTAATGGATGACATTCTCGAGAATGTCATCCATTAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020148
VALIDATED
SPIRE1 MISSION shRNA shRNA Plasmid DNA
spire-type actin nucleation factor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-672s21c1
Sequence:CCGGACTGAATCAGATGCACCAAATCTCGAGATTTGGTGCATCTGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1683s21c1
Sequence:CCGGGTGGAAGAAGTGATGCATATTCTCGAGAATATGCATCACTTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-2120s21c1
Sequence:CCGGCAAGAAGTTCATTTCGGAAATCTCGAGATTTCCGAAATGAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-615s21c1
Sequence:CCGGATCTCAGCTATTCGGTCATATCTCGAGATATGACCGAATAGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020148.2-2567s1c1
Sequence:CCGGCTTTACTGTTCCTCGAATAATCTCGAGATTATTCGAGGAACAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.2-380s1c1
Sequence:CCGGTGCGGGTAAATTGGGATATTCCTCGAGGAATATCCCAATTTACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1015s21c1
Sequence:CCGGTGATGGTGAATGGTGATATTCCTCGAGGAATATCACCATTCACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1661s21c1
Sequence:CCGGAGTGGAATGCCTCGCTCTTACCTCGAGGTAAGAGCGAGGCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.1-845s1c1
Sequence:CCGGCAAAGAATCTTGTGGAGTCATCTCGAGATGACTCCACAAGATTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020148.1-1540s1c1
Sequence:CCGGGAAAGTAGTATGAGGTCAGAACTCGAGTTCTGACCTCATACTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.1-553s1c1
Sequence:CCGGGAGATGTTAATGGATGACATTCTCGAGAATGTCATCCATTAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020148
VALIDATED
SPIRE1 MISSION shRNA Lentiviral Transduction Particles
spire-type actin nucleation factor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-672s21c1
Sequence:CCGGACTGAATCAGATGCACCAAATCTCGAGATTTGGTGCATCTGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1683s21c1
Sequence:CCGGGTGGAAGAAGTGATGCATATTCTCGAGAATATGCATCACTTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-2120s21c1
Sequence:CCGGCAAGAAGTTCATTTCGGAAATCTCGAGATTTCCGAAATGAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-615s21c1
Sequence:CCGGATCTCAGCTATTCGGTCATATCTCGAGATATGACCGAATAGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020148.2-2567s1c1
Sequence:CCGGCTTTACTGTTCCTCGAATAATCTCGAGATTATTCGAGGAACAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.2-380s1c1
Sequence:CCGGTGCGGGTAAATTGGGATATTCCTCGAGGAATATCCCAATTTACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1015s21c1
Sequence:CCGGTGATGGTGAATGGTGATATTCCTCGAGGAATATCACCATTCACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020148.2-1661s21c1
Sequence:CCGGAGTGGAATGCCTCGCTCTTACCTCGAGGTAAGAGCGAGGCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.1-845s1c1
Sequence:CCGGCAAAGAATCTTGTGGAGTCATCTCGAGATGACTCCACAAGATTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020148.1-1540s1c1
Sequence:CCGGGAAAGTAGTATGAGGTCAGAACTCGAGTTCTGACCTCATACTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020148.1-553s1c1
Sequence:CCGGGAGATGTTAATGGATGACATTCTCGAGAATGTCATCCATTAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176832
SPIRE1 MISSION shRNA Bacterial Glycerol Stock
spire-type actin nucleation factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-670s1c1
Sequence:CCGGGAGAATCATCTATGGTGAATGCTCGAGCATTCACCATAGATGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-1303s1c1
Sequence:CCGGCATACTCTACTCTACCTATCTCTCGAGAGATAGGTAGAGTAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-462s1c1
Sequence:CCGGGAGGTCATCCTTGACTTTATCCTCGAGGATAAAGTCAAGGATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176832.1-2800s1c1
Sequence:CCGGGCTTAGAAATAACTGGGCAATCTCGAGATTGCCCAGTTATTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176832.1-174s1c1
Sequence:CCGGGAGAACCTTAAGAAGATTCAACTCGAGTTGAATCTTCTTAAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176832.1-2165s1c1
Sequence:CCGGGCCTTGCTGATAATTCTCTTTCTCGAGAAAGAGAATTATCAGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.1-366s1c1
Sequence:CCGGGAGATGCTCATGGACGACATTCTCGAGAATGTCGTCCATGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176832.1-1649s1c1
Sequence:CCGGCCCTTCAGAACGGACTATCAACTCGAGTTGATAGTCCGTTCTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176832
SPIRE1 MISSION shRNA shRNA Plasmid DNA
spire-type actin nucleation factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-670s1c1
Sequence:CCGGGAGAATCATCTATGGTGAATGCTCGAGCATTCACCATAGATGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-1303s1c1
Sequence:CCGGCATACTCTACTCTACCTATCTCTCGAGAGATAGGTAGAGTAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-462s1c1
Sequence:CCGGGAGGTCATCCTTGACTTTATCCTCGAGGATAAAGTCAAGGATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176832.1-2800s1c1
Sequence:CCGGGCTTAGAAATAACTGGGCAATCTCGAGATTGCCCAGTTATTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176832.1-174s1c1
Sequence:CCGGGAGAACCTTAAGAAGATTCAACTCGAGTTGAATCTTCTTAAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176832.1-2165s1c1
Sequence:CCGGGCCTTGCTGATAATTCTCTTTCTCGAGAAAGAGAATTATCAGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.1-366s1c1
Sequence:CCGGGAGATGCTCATGGACGACATTCTCGAGAATGTCGTCCATGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176832.1-1649s1c1
Sequence:CCGGCCCTTCAGAACGGACTATCAACTCGAGTTGATAGTCCGTTCTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176832
SPIRE1 MISSION shRNA Lentiviral Transduction Particles
spire-type actin nucleation factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-670s1c1
Sequence:CCGGGAGAATCATCTATGGTGAATGCTCGAGCATTCACCATAGATGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-1303s1c1
Sequence:CCGGCATACTCTACTCTACCTATCTCTCGAGAGATAGGTAGAGTAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.2-462s1c1
Sequence:CCGGGAGGTCATCCTTGACTTTATCCTCGAGGATAAAGTCAAGGATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176832.1-2800s1c1
Sequence:CCGGGCTTAGAAATAACTGGGCAATCTCGAGATTGCCCAGTTATTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176832.1-174s1c1
Sequence:CCGGGAGAACCTTAAGAAGATTCAACTCGAGTTGAATCTTCTTAAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176832.1-2165s1c1
Sequence:CCGGGCCTTGCTGATAATTCTCTTTCTCGAGAAAGAGAATTATCAGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176832.1-366s1c1
Sequence:CCGGGAGATGCTCATGGACGACATTCTCGAGAATGTCGTCCATGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176832.1-1649s1c1
Sequence:CCGGCCCTTCAGAACGGACTATCAACTCGAGTTGATAGTCCGTTCTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks