EMAIL THIS PAGE TO A FRIEND

SPIRE2

spire-type actin nucleation factor 2

Synonyms: Spir-2
UniProtKB ID: Q8WWL2, A4QPB1, Q2TA98, Q6P433, Q8ND47, Q96JJ5
Gene ID:
Mouse(234857) spire homolog 2 (Drosophila)
Rat(307925) spire homolog 2 (Drosophila)
Zebrafish(492470) spire homolog 2 (Drosophila)
chicken(415855) spire homolog 2 (Drosophila)
domestic cat(101081690) spire homolog 2 (Drosophila)
Horse(100052609) spire homolog 2 (Drosophila)
dog(479609) spire homolog 2 (Drosophila)
naked mole-rat(101697693) spire homolog 2 (Drosophila)
Domestic Rabbit(100341065) spire homolog 2 (Drosophila)
domestic guinea pig(100732609) spire homolog 2 (Drosophila)
cow(518761) spire homolog 2 (Drosophila)
sheep(101112252) spire homolog 2 (Drosophila)
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016261 MISSION® esiRNA esiRNA targeting mouse Spire2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032451 Rosetta Predictions human pricing
NM_001127538 Rosetta Predictions rat pricing
NM_172287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138124 predicted 1917
2 SASI_Hs01_00138125 predicted 780
3 SASI_Hs01_00138126 predicted 1830
4 SASI_Hs01_00138129 predicted 1017
5 SASI_Hs01_00138130 predicted 1508
6 SASI_Hs01_00138132 predicted 1694
7 SASI_Hs02_00359875 predicted 775
8 SASI_Hs02_00359876 predicted 1791
9 SASI_Hs02_00359877 predicted 314
10 SASI_Hs02_00359878 predicted 1899
11 SASI_Hs01_00138127 predicted 1310
12 SASI_Hs01_00138128 predicted 1894
13 SASI_Hs01_00138131 predicted 1965
14 SASI_Hs01_00138133 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254133 predicted 1754
2 SASI_Rn02_00254134 predicted 1154
3 SASI_Rn02_00254135 predicted 981
4 SASI_Rn02_00254136 predicted 1688
5 SASI_Rn02_00254137 predicted 882
6 SASI_Rn02_00254138 predicted 1248
7 SASI_Rn02_00254139 predicted 292
8 SASI_Rn02_00254140 predicted 1787
9 SASI_Rn02_00254141 predicted 949
10 SASI_Rn02_00254142 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118832 predicted 1848
2 SASI_Mm01_00118833 predicted 1202
3 SASI_Mm01_00118834 predicted 988
4 SASI_Mm01_00118835 predicted 1902
5 SASI_Mm01_00118836 predicted 959
6 SASI_Mm01_00118837 predicted 338
7 SASI_Mm01_00118838 predicted 1904
8 SASI_Mm01_00118839 predicted 556
9 SASI_Mm01_00118841 predicted 1027
10 SASI_Mm02_00343772 predicted 319
11 SASI_Mm01_00118840 predicted 1233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032451
SPIRE2 MISSION shRNA Bacterial Glycerol Stock
spire-type actin nucleation factor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032451.1-2816s1c1
Sequence:CCGGGCCTGGCCAACATGATGAAATCTCGAGATTTCATCATGTTGGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032451.1-2826s1c1
Sequence:CCGGCATGATGAAATGTTGTCTCTACTCGAGTAGAGACAACATTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1296s21c1
Sequence:CCGGCTGAAATGGAAGAGATGAATACTCGAGTATTCATCTCTTCCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-986s21c1
Sequence:CCGGGAGCTCATCCTGGACTTTATCCTCGAGGATAAAGTCCAGGATGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1953s21c1
Sequence:CCGGTCCAGAGAAGAGACATCTTTCCTCGAGGAAAGATGTCTCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032451.1-2535s21c1
Sequence:CCGGAGGAATGCGAACGGCAGTTTCCTCGAGGAAACTGCCGTTCGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1838s21c1
Sequence:CCGGTGCACTTCCTGTAGCATAAAGCTCGAGCTTTATGCTACAGGAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032451
SPIRE2 MISSION shRNA shRNA Plasmid DNA
spire-type actin nucleation factor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032451.1-2816s1c1
Sequence:CCGGGCCTGGCCAACATGATGAAATCTCGAGATTTCATCATGTTGGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032451.1-2826s1c1
Sequence:CCGGCATGATGAAATGTTGTCTCTACTCGAGTAGAGACAACATTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1296s21c1
Sequence:CCGGCTGAAATGGAAGAGATGAATACTCGAGTATTCATCTCTTCCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-986s21c1
Sequence:CCGGGAGCTCATCCTGGACTTTATCCTCGAGGATAAAGTCCAGGATGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1953s21c1
Sequence:CCGGTCCAGAGAAGAGACATCTTTCCTCGAGGAAAGATGTCTCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032451.1-2535s21c1
Sequence:CCGGAGGAATGCGAACGGCAGTTTCCTCGAGGAAACTGCCGTTCGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1838s21c1
Sequence:CCGGTGCACTTCCTGTAGCATAAAGCTCGAGCTTTATGCTACAGGAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032451
SPIRE2 MISSION shRNA Lentiviral Transduction Particles
spire-type actin nucleation factor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032451.1-2816s1c1
Sequence:CCGGGCCTGGCCAACATGATGAAATCTCGAGATTTCATCATGTTGGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032451.1-2826s1c1
Sequence:CCGGCATGATGAAATGTTGTCTCTACTCGAGTAGAGACAACATTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1296s21c1
Sequence:CCGGCTGAAATGGAAGAGATGAATACTCGAGTATTCATCTCTTCCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-986s21c1
Sequence:CCGGGAGCTCATCCTGGACTTTATCCTCGAGGATAAAGTCCAGGATGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1953s21c1
Sequence:CCGGTCCAGAGAAGAGACATCTTTCCTCGAGGAAAGATGTCTCTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032451.1-2535s21c1
Sequence:CCGGAGGAATGCGAACGGCAGTTTCCTCGAGGAAACTGCCGTTCGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032451.1-1838s21c1
Sequence:CCGGTGCACTTCCTGTAGCATAAAGCTCGAGCTTTATGCTACAGGAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172287
VALIDATED
SPIRE2 MISSION shRNA Bacterial Glycerol Stock
spire-type actin nucleation factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-1849s21c1
Sequence:CCGGGTGCACTTCCTGTAGCGTAAACTCGAGTTTACGCTACAGGAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-2159s21c1
Sequence:CCGGCAGACCCAGTCCCTCTATATCCTCGAGGATATAGAGGGACTGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-982s21c1
Sequence:CCGGGAAGGACGCACATGAACTTATCTCGAGATAAGTTCATGTGCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-362s21c1
Sequence:CCGGTCACTGGGCTTTGCCATTTACCTCGAGGTAAATGGCAAAGCCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-916s21c1
Sequence:CCGGTATCCGTGCCAGGAACTATAACTCGAGTTATAGTTCCTGGCACGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172287
VALIDATED
SPIRE2 MISSION shRNA shRNA Plasmid DNA
spire-type actin nucleation factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-1849s21c1
Sequence:CCGGGTGCACTTCCTGTAGCGTAAACTCGAGTTTACGCTACAGGAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-2159s21c1
Sequence:CCGGCAGACCCAGTCCCTCTATATCCTCGAGGATATAGAGGGACTGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-982s21c1
Sequence:CCGGGAAGGACGCACATGAACTTATCTCGAGATAAGTTCATGTGCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-362s21c1
Sequence:CCGGTCACTGGGCTTTGCCATTTACCTCGAGGTAAATGGCAAAGCCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-916s21c1
Sequence:CCGGTATCCGTGCCAGGAACTATAACTCGAGTTATAGTTCCTGGCACGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172287
VALIDATED
SPIRE2 MISSION shRNA Lentiviral Transduction Particles
spire-type actin nucleation factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-1849s21c1
Sequence:CCGGGTGCACTTCCTGTAGCGTAAACTCGAGTTTACGCTACAGGAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-2159s21c1
Sequence:CCGGCAGACCCAGTCCCTCTATATCCTCGAGGATATAGAGGGACTGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-982s21c1
Sequence:CCGGGAAGGACGCACATGAACTTATCTCGAGATAAGTTCATGTGCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-362s21c1
Sequence:CCGGTCACTGGGCTTTGCCATTTACCTCGAGGTAAATGGCAAAGCCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172287.2-916s21c1
Sequence:CCGGTATCCGTGCCAGGAACTATAACTCGAGTTATAGTTCCTGGCACGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks