EMAIL THIS PAGE TO A FRIEND

SPN

sialophorin

Synonyms: CD43 GALGP GPL115 LSN
UniProtKB ID: P16150
Gene ID:
Human(6693) Summary: The protein encoded by this gene is a major sialoglycoprotein found on the surface of thymocytes, T lymphocytes, monocytes, granulocytes, and some B lymphocytes. It may be part of a physiologic ligand-receptor complex involved in T-cell activation. During T-cell activation, this protein is actively removed from the T-cell-APC (antigen-presenting cell) contact site, suggesting a negative regulatory role in adaptive immune response. [provided by RefSeq, Sep 2011]
Mouse(20737) sialophorin
Rat(24796) sialophorin
cow(614645) sialophorin
sheep(101120462) sialophorin
fruit fly(46194) Spinophilin
dog(479781) sialophorin
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500067 Anti-CD43 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP55, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
S5575 Anti-SPN (241-255) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406471 Anti-SPN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, western blot pricing
HPA055244 Anti-SPN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4700508 Monoclonal Anti-CD43 antibody produced in mouse clone MEM-59, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700507 Monoclonal Anti-CD43, azide free antibody produced in mouse clone MEM-59, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700510 Monoclonal Anti-CD43-Biotin antibody produced in mouse clone MEM-59, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700511 Monoclonal Anti-CD43-FITC antibody produced in mouse clone MEM-59, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700512 Monoclonal Anti-CD43-PE antibody produced in mouse clone MEM-59, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0006693M1 Monoclonal Anti-SPN antibody produced in mouse clone 3G8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003123 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009259 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009259 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009259 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150491 MISSION® esiRNA esiRNA human SPN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030288 Rosetta Predictions human pricing
NM_003123 Rosetta Predictions human pricing
XM_001080140 Rosetta Predictions rat pricing
XM_344964 Rosetta Predictions rat pricing
NM_001037810 Rosetta Predictions mouse pricing
NM_009259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307645 predicted 470
2 SASI_Hs01_00046648 predicted 633
3 SASI_Hs01_00046649 predicted 1158
4 SASI_Hs01_00046651 predicted 513
5 SASI_Hs02_00307646 predicted 866
6 SASI_Hs01_00046653 predicted 1097
7 SASI_Hs01_00046654 predicted 690
8 SASI_Hs01_00046655 predicted 697
9 SASI_Hs01_00046656 predicted 555
10 SASI_Hs01_00046657 predicted 747
11 SASI_Hs01_00046650 predicted 645
12 SASI_Hs01_00046652 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335107 predicted 428
2 SASI_Hs01_00226222 predicted 591
3 SASI_Hs01_00226223 predicted 1106
4 SASI_Hs01_00226225 predicted 474
5 SASI_Hs02_00335108 predicted 821
6 SASI_Hs01_00226227 predicted 1057
7 SASI_Hs01_00226228 predicted 643
8 SASI_Hs01_00226229 predicted 657
9 SASI_Hs01_00226230 predicted 512
10 SASI_Hs01_00226231 predicted 703
11 SASI_Hs01_00226224 predicted 601
12 SASI_Hs01_00226226 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366775 predicted 1190
2 SASI_Rn02_00366776 predicted 504
3 SASI_Rn02_00366777 predicted 1409
4 SASI_Rn02_00366778 predicted 1475
5 SASI_Rn02_00366779 predicted 472
6 SASI_Rn02_00366780 predicted 1343
7 SASI_Rn02_00366781 predicted 594
8 SASI_Rn02_00366782 predicted 1330
9 SASI_Rn02_00366783 predicted 609
10 SASI_Rn02_00366784 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397811 predicted 1188
2 SASI_Rn02_00397812 predicted 499
3 SASI_Rn02_00397813 predicted 1473
4 SASI_Rn02_00397814 predicted 1259
5 SASI_Rn02_00397815 predicted 305
6 SASI_Rn02_00397816 predicted 477
7 SASI_Rn02_00397817 predicted 69
8 SASI_Rn02_00397818 predicted 610
9 SASI_Rn02_00397819 predicted 90
10 SASI_Rn02_00397820 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141018 predicted 724
2 SASI_Mm01_00141020 predicted 797
3 SASI_Mm01_00141021 predicted 405
4 SASI_Mm02_00289446 predicted 1057
5 SASI_Mm01_00141022 predicted 396
6 SASI_Mm01_00141023 predicted 416
7 SASI_Mm01_00141024 predicted 194
8 SASI_Mm01_00141026 predicted 908
9 SASI_Mm01_00141027 predicted 1049
10 SASI_Mm02_00289447 predicted 303
11 SASI_Mm01_00141019 predicted 763
12 SASI_Mm01_00141025 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163345 predicted 721
2 SASI_Mm01_00163347 predicted 794
3 SASI_Mm01_00163348 predicted 406
4 SASI_Mm02_00315739 predicted 1061
5 SASI_Mm01_00163349 predicted 392
6 SASI_Mm01_00163350 predicted 415
7 SASI_Mm01_00163351 predicted 194
8 SASI_Mm01_00163353 predicted 910
9 SASI_Mm01_00163354 predicted 1052
10 SASI_Mm02_00315740 predicted 300
11 SASI_Mm01_00163346 predicted 762
12 SASI_Mm01_00163352 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003123
SPN MISSION shRNA Bacterial Glycerol Stock
sialophorin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-610s1c1
Sequence:CCGGCAACTGTCTCTCTGGAGACTTCTCGAGAAGTCTCCAGAGAGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-615s1c1
Sequence:CCGGGTCTCTCTGGAGACTTCCAAACTCGAGTTTGGAAGTCTCCAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-380s1c1
Sequence:CCGGCCAGGAAGTTTCCATCAAGATCTCGAGATCTTGATGGAAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-217s1c1
Sequence:CCGGGCTCAAAGATGTACACCACTTCTCGAGAAGTGGTGTACATCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003123.2-1926s1c1
Sequence:CCGGGCCTTTATCATCTAGGGAGTACTCGAGTACTCCCTAGATGATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-377s1c1
Sequence:CCGGCTACCAGGAAGTTTCCATCAACTCGAGTTGATGGAAACTTCCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-369s1c1
Sequence:CCGGCCAACAACCTACCAGGAAGTTCTCGAGAACTTCCTGGTAGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-502s1c1
Sequence:CCGGCAACGAACTCTCCAGAAACCTCTCGAGAGGTTTCTGGAGAGTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003123.2-1866s1c1
Sequence:CCGGCCCTCCTCTTACAAATGCCAACTCGAGTTGGCATTTGTAAGAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003123
SPN MISSION shRNA shRNA Plasmid DNA
sialophorin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-610s1c1
Sequence:CCGGCAACTGTCTCTCTGGAGACTTCTCGAGAAGTCTCCAGAGAGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-615s1c1
Sequence:CCGGGTCTCTCTGGAGACTTCCAAACTCGAGTTTGGAAGTCTCCAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-380s1c1
Sequence:CCGGCCAGGAAGTTTCCATCAAGATCTCGAGATCTTGATGGAAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-217s1c1
Sequence:CCGGGCTCAAAGATGTACACCACTTCTCGAGAAGTGGTGTACATCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003123.2-1926s1c1
Sequence:CCGGGCCTTTATCATCTAGGGAGTACTCGAGTACTCCCTAGATGATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-377s1c1
Sequence:CCGGCTACCAGGAAGTTTCCATCAACTCGAGTTGATGGAAACTTCCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-369s1c1
Sequence:CCGGCCAACAACCTACCAGGAAGTTCTCGAGAACTTCCTGGTAGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-502s1c1
Sequence:CCGGCAACGAACTCTCCAGAAACCTCTCGAGAGGTTTCTGGAGAGTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003123.2-1866s1c1
Sequence:CCGGCCCTCCTCTTACAAATGCCAACTCGAGTTGGCATTTGTAAGAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003123
SPN MISSION shRNA Lentiviral Transduction Particles
sialophorin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-610s1c1
Sequence:CCGGCAACTGTCTCTCTGGAGACTTCTCGAGAAGTCTCCAGAGAGACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-615s1c1
Sequence:CCGGGTCTCTCTGGAGACTTCCAAACTCGAGTTTGGAAGTCTCCAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-380s1c1
Sequence:CCGGCCAGGAAGTTTCCATCAAGATCTCGAGATCTTGATGGAAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-217s1c1
Sequence:CCGGGCTCAAAGATGTACACCACTTCTCGAGAAGTGGTGTACATCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003123.2-1926s1c1
Sequence:CCGGGCCTTTATCATCTAGGGAGTACTCGAGTACTCCCTAGATGATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-377s1c1
Sequence:CCGGCTACCAGGAAGTTTCCATCAACTCGAGTTGATGGAAACTTCCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-369s1c1
Sequence:CCGGCCAACAACCTACCAGGAAGTTCTCGAGAACTTCCTGGTAGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003123.2-502s1c1
Sequence:CCGGCAACGAACTCTCCAGAAACCTCTCGAGAGGTTTCTGGAGAGTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003123.2-1866s1c1
Sequence:CCGGCCCTCCTCTTACAAATGCCAACTCGAGTTGGCATTTGTAAGAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009259
SPN MISSION shRNA Bacterial Glycerol Stock
sialophorin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009259.3-2222s1c1
Sequence:CCGGGCAGGGTAATAAGAGAGAGTTCTCGAGAACTCTCTCTTATTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-732s1c1
Sequence:CCGGCCAAGAATCAAGTGGCATGTTCTCGAGAACATGCCACTTGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-98s1c1
Sequence:CCGGCACATATCACAGCTCCAAGTACTCGAGTACTTGGAGCTGTGATATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-626s1c1
Sequence:CCGGCAACCAGTTCTGTGGAGAGTTCTCGAGAACTCTCCACAGAACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-440s1c1
Sequence:CCGGCAGCATCTACATCTATCTCTACTCGAGTAGAGATAGATGTAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009259
SPN MISSION shRNA shRNA Plasmid DNA
sialophorin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009259.3-2222s1c1
Sequence:CCGGGCAGGGTAATAAGAGAGAGTTCTCGAGAACTCTCTCTTATTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-732s1c1
Sequence:CCGGCCAAGAATCAAGTGGCATGTTCTCGAGAACATGCCACTTGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-98s1c1
Sequence:CCGGCACATATCACAGCTCCAAGTACTCGAGTACTTGGAGCTGTGATATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-626s1c1
Sequence:CCGGCAACCAGTTCTGTGGAGAGTTCTCGAGAACTCTCCACAGAACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-440s1c1
Sequence:CCGGCAGCATCTACATCTATCTCTACTCGAGTAGAGATAGATGTAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009259
SPN MISSION shRNA Lentiviral Transduction Particles
sialophorin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009259.3-2222s1c1
Sequence:CCGGGCAGGGTAATAAGAGAGAGTTCTCGAGAACTCTCTCTTATTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-732s1c1
Sequence:CCGGCCAAGAATCAAGTGGCATGTTCTCGAGAACATGCCACTTGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-98s1c1
Sequence:CCGGCACATATCACAGCTCCAAGTACTCGAGTACTTGGAGCTGTGATATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-626s1c1
Sequence:CCGGCAACCAGTTCTGTGGAGAGTTCTCGAGAACTCTCCACAGAACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009259.3-440s1c1
Sequence:CCGGCAGCATCTACATCTATCTCTACTCGAGTAGAGATAGATGTAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks