EMAIL THIS PAGE TO A FRIEND

SPNS1

spinster homolog 1 (Drosophila)

Synonyms: HSpin1 LAT PP2030 SPIN1 SPINL nrs
Gene ID:
Mouse(73658) spinster homolog 1
Rat(361648) spinster homolog 1 (Drosophila)
Zebrafish(799873) spinster homolog 1 (Drosophila)
dog(489953) spinster homolog 1 (Drosophila)
domestic cat(101092725) spinster homolog 1 (Drosophila)
cow(505997) spinster homolog 1 (Drosophila)
sheep(101110989) spinster homolog 1 (Drosophila)
naked mole-rat(101712780) spinster homolog 1 (Drosophila)
domestic guinea pig(100725068) spinster homolog 1 (Drosophila)
191 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032038 Rosetta Predictions human pricing
NM_001039208 Rosetta Predictions rat pricing
NM_023712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245562 predicted 1525
2 SASI_Hs01_00245563 predicted 1452
3 SASI_Hs01_00245564 predicted 939
4 SASI_Hs01_00245565 predicted 1449
5 SASI_Hs01_00245566 predicted 1007
6 SASI_Hs01_00245568 predicted 1887
7 SASI_Hs01_00245569 predicted 675
8 SASI_Hs01_00245570 predicted 1834
9 SASI_Hs01_00245571 predicted 1276
10 SASI_Hs02_00359235 predicted 1828
11 SASI_Hs01_00245567 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100003 predicted 677
2 SASI_Rn01_00100004 predicted 494
3 SASI_Rn01_00100005 predicted 676
4 SASI_Rn01_00100006 predicted 1372
5 SASI_Rn01_00100007 predicted 576
6 SASI_Rn02_00204806 predicted 944
7 SASI_Rn02_00204807 predicted 1507
8 SASI_Rn01_00100011 predicted 692
9 SASI_Rn01_00100012 predicted 607
10 SASI_Rn02_00204808 predicted 841
11 SASI_Rn01_00100008 predicted 929
12 SASI_Rn01_00100009 predicted 1453
13 SASI_Rn01_00100010 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139563 predicted 2371
2 SASI_Mm01_00139565 predicted 1991
3 SASI_Mm01_00139567 predicted 2447
4 SASI_Mm01_00139568 predicted 2158
5 SASI_Mm01_00139569 predicted 1136
6 SASI_Mm01_00139570 predicted 1655
7 SASI_Mm01_00139571 predicted 2115
8 SASI_Mm02_00327302 predicted 2237
9 SASI_Mm01_00139572 predicted 2159
10 SASI_Mm02_00327303 predicted 2367
11 SASI_Mm01_00139564 predicted 706
12 SASI_Mm01_00139566 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032038
SPNS1 MISSION shRNA Bacterial Glycerol Stock
spinster homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-1122s1c1
Sequence:CCGGTCTGGCAAGAAATCCTAGTTTCTCGAGAAACTAGGATTTCTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-682s1c1
Sequence:CCGGGACAGGTACAATCGGAAGTATCTCGAGATACTTCCGATTGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-630s1c1
Sequence:CCGGCGTGTTCATCTCCAGTTACATCTCGAGATGTAACTGGAGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-516s1c1
Sequence:CCGGGCTGTGCTACATCAATCTCCTCTCGAGAGGAGATTGATGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-1287s1c1
Sequence:CCGGCAGTCTCATCTTTGGACTCATCTCGAGATGAGTCCAAAGATGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-626s21c1
Sequence:CCGCTCCCGACATCGAGCAGTTCTTCTCGAGAAGAACTGCTCGATGTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1589s21c1
Sequence:CCGGCATTCTGCTGTACGTGGTGATCTCGAGATCACCACGTACAGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1514s21c1
Sequence:CCGGTAGCATCGTGGCCACTTATATCTCGAGATATAAGTGGCCACGATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1767s21c1
Sequence:CCGGCTCATGCTCTGCGCGTTTGTTCTCGAGAACAAACGCGCAGAGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-982s21c1
Sequence:CCGGGCTACATTGCAGGCTCCAAAGCTCGAGCTTTGGAGCCTGCAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032038
SPNS1 MISSION shRNA shRNA Plasmid DNA
spinster homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-1122s1c1
Sequence:CCGGTCTGGCAAGAAATCCTAGTTTCTCGAGAAACTAGGATTTCTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-682s1c1
Sequence:CCGGGACAGGTACAATCGGAAGTATCTCGAGATACTTCCGATTGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-630s1c1
Sequence:CCGGCGTGTTCATCTCCAGTTACATCTCGAGATGTAACTGGAGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-516s1c1
Sequence:CCGGGCTGTGCTACATCAATCTCCTCTCGAGAGGAGATTGATGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-1287s1c1
Sequence:CCGGCAGTCTCATCTTTGGACTCATCTCGAGATGAGTCCAAAGATGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-626s21c1
Sequence:CCGCTCCCGACATCGAGCAGTTCTTCTCGAGAAGAACTGCTCGATGTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1589s21c1
Sequence:CCGGCATTCTGCTGTACGTGGTGATCTCGAGATCACCACGTACAGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1514s21c1
Sequence:CCGGTAGCATCGTGGCCACTTATATCTCGAGATATAAGTGGCCACGATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1767s21c1
Sequence:CCGGCTCATGCTCTGCGCGTTTGTTCTCGAGAACAAACGCGCAGAGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-982s21c1
Sequence:CCGGGCTACATTGCAGGCTCCAAAGCTCGAGCTTTGGAGCCTGCAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032038
SPNS1 MISSION shRNA Lentiviral Transduction Particles
spinster homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-1122s1c1
Sequence:CCGGTCTGGCAAGAAATCCTAGTTTCTCGAGAAACTAGGATTTCTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-682s1c1
Sequence:CCGGGACAGGTACAATCGGAAGTATCTCGAGATACTTCCGATTGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-630s1c1
Sequence:CCGGCGTGTTCATCTCCAGTTACATCTCGAGATGTAACTGGAGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-516s1c1
Sequence:CCGGGCTGTGCTACATCAATCTCCTCTCGAGAGGAGATTGATGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032038.1-1287s1c1
Sequence:CCGGCAGTCTCATCTTTGGACTCATCTCGAGATGAGTCCAAAGATGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-626s21c1
Sequence:CCGCTCCCGACATCGAGCAGTTCTTCTCGAGAAGAACTGCTCGATGTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1589s21c1
Sequence:CCGGCATTCTGCTGTACGTGGTGATCTCGAGATCACCACGTACAGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1514s21c1
Sequence:CCGGTAGCATCGTGGCCACTTATATCTCGAGATATAAGTGGCCACGATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-1767s21c1
Sequence:CCGGCTCATGCTCTGCGCGTTTGTTCTCGAGAACAAACGCGCAGAGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032038.2-982s21c1
Sequence:CCGGGCTACATTGCAGGCTCCAAAGCTCGAGCTTTGGAGCCTGCAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023712
VALIDATED
SPNS1 MISSION shRNA Bacterial Glycerol Stock
spinster homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-2030s1c1
Sequence:CCGGCCAAGAAGGAAGCCCTGGGATCTCGAGATCCCAGGGCTTCCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-1650s1c1
Sequence:CCGGCCCTTACCTCATTGGTCTAATCTCGAGATTAGACCAATGAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023712.1-543s1c1
Sequence:CCGGGTGCTACATTAACCTCCTGAACTCGAGTTCAGGAGGTTAATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023712.1-1789s1c1
Sequence:CCGGACCGCCATGTTCATTGAAGATCTCGAGATCTTCAATGAACATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-609s1c1
Sequence:CCGGGCAGTTCTTTAACATCGGAGACTCGAGTCTCCGATGTTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-2159s21c1
Sequence:CCGGCCCTTACCTCATTGGTCTAATCTCGAGATTAGACCAATGAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-2298s21c1
Sequence:CCGGACCGCCATGTTCATTGAAGATCTCGAGATCTTCAATGAACATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-1052s21c1
Sequence:CCGGGTGCTACATTAACCTCCTGAACTCGAGTTCAGGAGGTTAATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-1118s21c1
Sequence:CCGGGCAGTTCTTTAACATCGGAGACTCGAGTCTCCGATGTTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023712
VALIDATED
SPNS1 MISSION shRNA shRNA Plasmid DNA
spinster homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-2030s1c1
Sequence:CCGGCCAAGAAGGAAGCCCTGGGATCTCGAGATCCCAGGGCTTCCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-1650s1c1
Sequence:CCGGCCCTTACCTCATTGGTCTAATCTCGAGATTAGACCAATGAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023712.1-543s1c1
Sequence:CCGGGTGCTACATTAACCTCCTGAACTCGAGTTCAGGAGGTTAATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023712.1-1789s1c1
Sequence:CCGGACCGCCATGTTCATTGAAGATCTCGAGATCTTCAATGAACATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-609s1c1
Sequence:CCGGGCAGTTCTTTAACATCGGAGACTCGAGTCTCCGATGTTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-2159s21c1
Sequence:CCGGCCCTTACCTCATTGGTCTAATCTCGAGATTAGACCAATGAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-2298s21c1
Sequence:CCGGACCGCCATGTTCATTGAAGATCTCGAGATCTTCAATGAACATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-1052s21c1
Sequence:CCGGGTGCTACATTAACCTCCTGAACTCGAGTTCAGGAGGTTAATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-1118s21c1
Sequence:CCGGGCAGTTCTTTAACATCGGAGACTCGAGTCTCCGATGTTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023712
VALIDATED
SPNS1 MISSION shRNA Lentiviral Transduction Particles
spinster homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-2030s1c1
Sequence:CCGGCCAAGAAGGAAGCCCTGGGATCTCGAGATCCCAGGGCTTCCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-1650s1c1
Sequence:CCGGCCCTTACCTCATTGGTCTAATCTCGAGATTAGACCAATGAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023712.1-543s1c1
Sequence:CCGGGTGCTACATTAACCTCCTGAACTCGAGTTCAGGAGGTTAATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023712.1-1789s1c1
Sequence:CCGGACCGCCATGTTCATTGAAGATCTCGAGATCTTCAATGAACATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023712.1-609s1c1
Sequence:CCGGGCAGTTCTTTAACATCGGAGACTCGAGTCTCCGATGTTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-2159s21c1
Sequence:CCGGCCCTTACCTCATTGGTCTAATCTCGAGATTAGACCAATGAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-2298s21c1
Sequence:CCGGACCGCCATGTTCATTGAAGATCTCGAGATCTTCAATGAACATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-1052s21c1
Sequence:CCGGGTGCTACATTAACCTCCTGAACTCGAGTTCAGGAGGTTAATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023712.2-1118s21c1
Sequence:CCGGGCAGTTCTTTAACATCGGAGACTCGAGTCTCCGATGTTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks