EMAIL THIS PAGE TO A FRIEND

SPNS2

spinster homolog 2 (Drosophila)

UniProtKB ID: Q8IVW8, B9A1T3
Gene ID:
Mouse(216892) spinster homolog 2
Rat(100270678) spinster homolog 2
domestic guinea pig(100729353) spinster homolog 2 (Drosophila)
naked mole-rat(101699872) spinster homolog 2 (Drosophila)
cow(613889) spinster homolog 2 (Drosophila)
sheep(101112238) spinster homolog 2 (Drosophila)
Zebrafish(568117) spinster homolog 2 (Drosophila)
dog(606858) spinster homolog 2 (Drosophila)
domestic cat(101087534) spinster homolog 2 (Drosophila)
Horse(100072726) spinster homolog 2 (Drosophila)
chicken(417492) spinster homolog 2 (Drosophila)
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001124758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001124758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001124758 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001124758 Rosetta Predictions human pricing
XM_001723978 Rosetta Predictions human pricing
XM_001725485 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001124758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327954 predicted 1723
2 SASI_Hs02_00327955 predicted 1863
3 SASI_Hs02_00327956 predicted 1037
4 SASI_Hs02_00327957 predicted 1106
5 SASI_Hs02_00327958 predicted 1333
6 SASI_Hs02_00327959 predicted 1468
7 SASI_Hs02_00327960 predicted 1202
8 SASI_Hs02_00327961 predicted 1041
9 SASI_Hs02_00327962 predicted 871
10 SASI_Hs02_00327963 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00458757 predicted 1507
2 SASI_Hs02_00458758 predicted 1656
3 SASI_Hs02_00458759 predicted 823
4 SASI_Hs02_00458760 predicted 897
5 SASI_Hs02_00458761 predicted 1110
6 SASI_Hs02_00458762 predicted 1255
7 SASI_Hs02_00458763 predicted 994
8 SASI_Hs02_00458764 predicted 823
9 SASI_Hs02_00458765 predicted 650
10 SASI_Hs02_00458766 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00468064 predicted 1715
2 SASI_Hs02_00468065 predicted 1866
3 SASI_Hs02_00468066 predicted 1035
4 SASI_Hs02_00468067 predicted 1103
5 SASI_Hs02_00468068 predicted 1325
6 SASI_Hs02_00468069 predicted 1470
7 SASI_Hs02_00468070 predicted 1202
8 SASI_Hs02_00468071 predicted 1036
9 SASI_Hs02_00468072 predicted 870
10 SASI_Hs02_00468073 predicted 1471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001124758
SPNS2 MISSION shRNA Bacterial Glycerol Stock
spinster homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1111s21c1
Sequence:CCGGGACCTCATGGCTCCGAGATATCTCGAGATATCTCGGAGCCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1475s21c1
Sequence:CCGGAGCATCGTAGGAGCCTATATCCTCGAGGATATAGGCTCCTACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124758.1-2418s21c1
Sequence:CCGGATTGGACGCAACCTGGCAAATCTCGAGATTTGCCAGGTTGCGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1319s21c1
Sequence:CCGGATCACCTGCTTTACGGGATTTCTCGAGAAATCCCGTAAAGCAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-720s21c1
Sequence:CCGGTGATTCTCAGCTGCGGCATTTCTCGAGAAATGCCGCAGCTGAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001124758
SPNS2 MISSION shRNA shRNA Plasmid DNA
spinster homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1111s21c1
Sequence:CCGGGACCTCATGGCTCCGAGATATCTCGAGATATCTCGGAGCCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1475s21c1
Sequence:CCGGAGCATCGTAGGAGCCTATATCCTCGAGGATATAGGCTCCTACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124758.1-2418s21c1
Sequence:CCGGATTGGACGCAACCTGGCAAATCTCGAGATTTGCCAGGTTGCGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1319s21c1
Sequence:CCGGATCACCTGCTTTACGGGATTTCTCGAGAAATCCCGTAAAGCAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-720s21c1
Sequence:CCGGTGATTCTCAGCTGCGGCATTTCTCGAGAAATGCCGCAGCTGAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001124758
SPNS2 MISSION shRNA Lentiviral Transduction Particles
spinster homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1111s21c1
Sequence:CCGGGACCTCATGGCTCCGAGATATCTCGAGATATCTCGGAGCCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1475s21c1
Sequence:CCGGAGCATCGTAGGAGCCTATATCCTCGAGGATATAGGCTCCTACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124758.1-2418s21c1
Sequence:CCGGATTGGACGCAACCTGGCAAATCTCGAGATTTGCCAGGTTGCGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-1319s21c1
Sequence:CCGGATCACCTGCTTTACGGGATTTCTCGAGAAATCCCGTAAAGCAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124758.1-720s21c1
Sequence:CCGGTGATTCTCAGCTGCGGCATTTCTCGAGAAATGCCGCAGCTGAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks