EMAIL THIS PAGE TO A FRIEND

SPNS3

spinster homolog 3 (Drosophila)

UniProtKB ID: Q6ZMD2, Q8IZ31
Gene ID:
Mouse(77577) spinster homolog 3
Rat(497946) spinster homolog 3 (Drosophila)
Zebrafish(568387) spinster homolog 3 (Drosophila)
Horse(100072721) spinster homolog 3 (Drosophila)
domestic cat(101087278) spinster homolog 3 (Drosophila)
dog(606839) spinster homolog 3 (Drosophila)
chicken(417493) spinster homolog 3 (Drosophila)
cow(516041) spinster homolog 3 (Drosophila)
sheep(101111981) spinster homolog 3 (Drosophila)
naked mole-rat(101718258) spinster homolog 3 (Drosophila)
Domestic Rabbit(100350104) spinster homolog 3 (Drosophila)
domestic guinea pig(100729634) spinster homolog 3 (Drosophila)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182538 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182538 Rosetta Predictions human pricing
NM_001109035 Rosetta Predictions rat pricing
NM_029932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030782 predicted 371
2 SASI_Hs01_00030783 predicted 1031
3 SASI_Hs01_00030785 predicted 1105
4 SASI_Hs01_00030786 predicted 1305
5 SASI_Hs01_00030787 predicted 1387
6 SASI_Hs01_00030788 predicted 779
7 SASI_Hs01_00030789 predicted 840
8 SASI_Hs01_00030791 predicted 237
9 SASI_Hs02_00370644 predicted 378
10 SASI_Hs02_00370645 predicted 277
11 SASI_Hs01_00030784 predicted 286
12 SASI_Hs01_00030790 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244534 predicted 1468
2 SASI_Rn02_00244535 predicted 825
3 SASI_Rn02_00244536 predicted 1097
4 SASI_Rn02_00244537 predicted 1499
5 SASI_Rn02_00244538 predicted 1196
6 SASI_Rn02_00244539 predicted 777
7 SASI_Rn02_00244540 predicted 876
8 SASI_Rn02_00244541 predicted 1017
9 SASI_Rn02_00244542 predicted 549
10 SASI_Rn02_00244543 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131699 predicted 1395
2 SASI_Mm02_00336214 predicted 792
3 SASI_Mm01_00131700 predicted 999
4 SASI_Mm01_00131701 predicted 1398
5 SASI_Mm01_00131702 predicted 555
6 SASI_Mm01_00131703 predicted 1123
7 SASI_Mm01_00131704 predicted 363
8 SASI_Mm01_00131705 predicted 605
9 SASI_Mm01_00131706 predicted 1440
10 SASI_Mm01_00131707 predicted 230
11 SASI_Mm01_00131708 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029932
SPNS3 MISSION shRNA Bacterial Glycerol Stock
spinster homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029932.1-1610s1c1
Sequence:CCGGCAGGCTCAATCCTACCTACATCTCGAGATGTAGGTAGGATTGAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-1080s1c1
Sequence:CCGGCATCTGTGCTTCTAGTCTGTTCTCGAGAACAGACTAGAAGCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-993s1c1
Sequence:CCGGGACCGTGGCAACTGGTATTATCTCGAGATAATACCAGTTGCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-199s1c1
Sequence:CCGGGTTCTCTGTTACATCAACCTTCTCGAGAAGGTTGATGTAACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-499s1c1
Sequence:CCGGGCAGCAAGCTATTCCACCATTCTCGAGAATGGTGGAATAGCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029932
SPNS3 MISSION shRNA shRNA Plasmid DNA
spinster homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029932.1-1610s1c1
Sequence:CCGGCAGGCTCAATCCTACCTACATCTCGAGATGTAGGTAGGATTGAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-1080s1c1
Sequence:CCGGCATCTGTGCTTCTAGTCTGTTCTCGAGAACAGACTAGAAGCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-993s1c1
Sequence:CCGGGACCGTGGCAACTGGTATTATCTCGAGATAATACCAGTTGCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-199s1c1
Sequence:CCGGGTTCTCTGTTACATCAACCTTCTCGAGAAGGTTGATGTAACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-499s1c1
Sequence:CCGGGCAGCAAGCTATTCCACCATTCTCGAGAATGGTGGAATAGCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029932
SPNS3 MISSION shRNA Lentiviral Transduction Particles
spinster homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029932.1-1610s1c1
Sequence:CCGGCAGGCTCAATCCTACCTACATCTCGAGATGTAGGTAGGATTGAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-1080s1c1
Sequence:CCGGCATCTGTGCTTCTAGTCTGTTCTCGAGAACAGACTAGAAGCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-993s1c1
Sequence:CCGGGACCGTGGCAACTGGTATTATCTCGAGATAATACCAGTTGCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-199s1c1
Sequence:CCGGGTTCTCTGTTACATCAACCTTCTCGAGAAGGTTGATGTAACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029932.1-499s1c1
Sequence:CCGGGCAGCAAGCTATTCCACCATTCTCGAGAATGGTGGAATAGCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182538
SPNS3 MISSION shRNA Bacterial Glycerol Stock
spinster homolog 3 (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1033s1c1
Sequence:CCGGCGAGGAGGTACAAGAAAGTCACTCGAGTGACTTTCTTGTACCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-563s1c1
Sequence:CCGGGCTGGCTGTCTTCTACATCTTCTCGAGAAGATGTAGAAGACAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-282s1c1
Sequence:CCGGGACAACCATGCTGGTTTGCTTCTCGAGAAGCAAACCAGCATGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-278s1c1
Sequence:CCGGCAGTGACAACCATGCTGGTTTCTCGAGAAACCAGCATGGTTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1505s1c1
Sequence:CCGGCAGCAATGATGTGGACAGCAACTCGAGTTGCTGTCCACATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-292s1c1
Sequence:CCGGCTGGTTTGCTTCAGACTGTCTCTCGAGAGACAGTCTGAAGCAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-249s1c1
Sequence:CCGGCTGCTGGATATACAGGAGGTTCTCGAGAACCTCCTGTATATCCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1313s1c1
Sequence:CCGGCACAGGACTTATCTCTAGTGTCTCGAGACACTAGAGATAAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1034s1c1
Sequence:CCGGGAGGAGGTACAAGAAAGTCATCTCGAGATGACTTTCTTGTACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-212s1c1
Sequence:CCGGCCTGAATTACATGAACTGGTTCTCGAGAACCAGTTCATGTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-1306s1c1
Sequence:CCGGCCTATCTCACAGGACTTATCTCTCGAGAGATAAGTCCTGTGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-564s1c1
Sequence:CCGGCTGGCTGTCTTCTACATCTTTCTCGAGAAAGATGTAGAAGACAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182538
SPNS3 MISSION shRNA shRNA Plasmid DNA
spinster homolog 3 (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1033s1c1
Sequence:CCGGCGAGGAGGTACAAGAAAGTCACTCGAGTGACTTTCTTGTACCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-563s1c1
Sequence:CCGGGCTGGCTGTCTTCTACATCTTCTCGAGAAGATGTAGAAGACAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-282s1c1
Sequence:CCGGGACAACCATGCTGGTTTGCTTCTCGAGAAGCAAACCAGCATGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-278s1c1
Sequence:CCGGCAGTGACAACCATGCTGGTTTCTCGAGAAACCAGCATGGTTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1505s1c1
Sequence:CCGGCAGCAATGATGTGGACAGCAACTCGAGTTGCTGTCCACATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-292s1c1
Sequence:CCGGCTGGTTTGCTTCAGACTGTCTCTCGAGAGACAGTCTGAAGCAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-249s1c1
Sequence:CCGGCTGCTGGATATACAGGAGGTTCTCGAGAACCTCCTGTATATCCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1313s1c1
Sequence:CCGGCACAGGACTTATCTCTAGTGTCTCGAGACACTAGAGATAAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1034s1c1
Sequence:CCGGGAGGAGGTACAAGAAAGTCATCTCGAGATGACTTTCTTGTACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-212s1c1
Sequence:CCGGCCTGAATTACATGAACTGGTTCTCGAGAACCAGTTCATGTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-1306s1c1
Sequence:CCGGCCTATCTCACAGGACTTATCTCTCGAGAGATAAGTCCTGTGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-564s1c1
Sequence:CCGGCTGGCTGTCTTCTACATCTTTCTCGAGAAAGATGTAGAAGACAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182538
SPNS3 MISSION shRNA Lentiviral Transduction Particles
spinster homolog 3 (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1033s1c1
Sequence:CCGGCGAGGAGGTACAAGAAAGTCACTCGAGTGACTTTCTTGTACCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-563s1c1
Sequence:CCGGGCTGGCTGTCTTCTACATCTTCTCGAGAAGATGTAGAAGACAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-282s1c1
Sequence:CCGGGACAACCATGCTGGTTTGCTTCTCGAGAAGCAAACCAGCATGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-278s1c1
Sequence:CCGGCAGTGACAACCATGCTGGTTTCTCGAGAAACCAGCATGGTTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1505s1c1
Sequence:CCGGCAGCAATGATGTGGACAGCAACTCGAGTTGCTGTCCACATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-292s1c1
Sequence:CCGGCTGGTTTGCTTCAGACTGTCTCTCGAGAGACAGTCTGAAGCAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-249s1c1
Sequence:CCGGCTGCTGGATATACAGGAGGTTCTCGAGAACCTCCTGTATATCCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1313s1c1
Sequence:CCGGCACAGGACTTATCTCTAGTGTCTCGAGACACTAGAGATAAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-1034s1c1
Sequence:CCGGGAGGAGGTACAAGAAAGTCATCTCGAGATGACTTTCTTGTACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182538.3-212s1c1
Sequence:CCGGCCTGAATTACATGAACTGGTTCTCGAGAACCAGTTCATGTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-1306s1c1
Sequence:CCGGCCTATCTCACAGGACTTATCTCTCGAGAGATAAGTCCTGTGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182538.3-564s1c1
Sequence:CCGGCTGGCTGTCTTCTACATCTTTCTCGAGAAAGATGTAGAAGACAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks