EMAIL THIS PAGE TO A FRIEND

SPO11

SPO11 meiotic protein covalently bound to DSB

Synonyms: CT35 SPATA43 TOPVIA
UniProtKB ID: Q9Y5K1, Q5TCI1, Q8N4V0, Q9NQM7, Q9NQM8
Gene ID:
Human(23626) Summary: Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008]
Mouse(26972) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
Rat(366261) SPO11 meiotic protein covalently bound to DSB
Zebrafish(402982) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
chicken(768915) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
domestic cat(101090003) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
Horse(100050365) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
dog(610247) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
cow(524105) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
sheep(101118122) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
Domestic Rabbit(100359270) SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)
naked mole-rat(101706565) SPO11 meiotic protein covalently bound to DSB
domestic guinea pig(100725083) SPO11 meiotic protein covalently bound to DSB
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407237 Anti-SPO11 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2102289 Anti-SPO11 antibody produced in rabbit affinity isolated antibody rat, mouse, human, guinea pig, horse, rabbit, canine, bovine, pig, zebrafish
western blot pricing
SAB1401596 Anti-SPO11 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012444 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012444 Rosetta Predictions human pricing
NM_198265 Rosetta Predictions human pricing
NM_001108964 Rosetta Predictions rat pricing
NM_001083959 Rosetta Predictions mouse pricing
NM_001083960 Rosetta Predictions mouse pricing
NM_012046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199524 predicted 947
2 SASI_Hs01_00199525 predicted 1158
3 SASI_Hs01_00199526 predicted 735
4 SASI_Hs01_00199528 predicted 768
5 SASI_Hs01_00199529 predicted 586
6 SASI_Hs01_00199530 predicted 1093
7 SASI_Hs02_00344344 predicted 1233
8 SASI_Hs02_00344345 predicted 1297
9 SASI_Hs01_00199533 predicted 1010
10 SASI_Hs02_00344346 predicted 847
11 SASI_Hs01_00199527 predicted 722
12 SASI_Hs01_00199531 predicted 873
13 SASI_Hs01_00199532 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069944 predicted 831
2 SASI_Hs01_00069945 predicted 1049
3 SASI_Hs01_00069946 predicted 624
4 SASI_Hs01_00069948 predicted 656
5 SASI_Hs01_00069949 predicted 470
6 SASI_Hs01_00069950 predicted 975
7 SASI_Hs02_00371814 predicted 1119
8 SASI_Hs02_00371815 predicted 1183
9 SASI_Hs01_00069953 predicted 896
10 SASI_Hs02_00371816 predicted 730
11 SASI_Hs01_00069947 predicted 600
12 SASI_Hs01_00069951 predicted 762
13 SASI_Hs01_00069952 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243824 predicted 1082
2 SASI_Rn02_00243825 predicted 222
3 SASI_Rn02_00243826 predicted 374
4 SASI_Rn02_00243827 predicted 1185
5 SASI_Rn02_00243828 predicted 562
6 SASI_Rn02_00243829 predicted 435
7 SASI_Rn02_00243830 predicted 418
8 SASI_Rn02_00243831 predicted 300
9 SASI_Rn02_00243832 predicted 1059
10 SASI_Rn02_00243833 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300165 predicted 921
2 SASI_Mm02_00300166 predicted 874
3 SASI_Mm02_00300167 predicted 1144
4 SASI_Mm02_00300168 predicted 1243
5 SASI_Mm02_00300169 predicted 1101
6 SASI_Mm02_00300170 predicted 978
7 SASI_Mm02_00300171 predicted 999
8 SASI_Mm02_00300172 predicted 585
9 SASI_Mm02_00300173 predicted 846
10 SASI_Mm02_00300174 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300175 predicted 877
2 SASI_Mm02_00300176 predicted 843
3 SASI_Mm02_00300177 predicted 1105
4 SASI_Mm02_00300178 predicted 1201
5 SASI_Mm02_00300179 predicted 1068
6 SASI_Mm02_00300180 predicted 940
7 SASI_Mm02_00300181 predicted 959
8 SASI_Mm02_00300182 predicted 547
9 SASI_Mm02_00300183 predicted 805
10 SASI_Mm02_00300184 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140908 predicted 995
2 SASI_Mm02_00322013 predicted 957
3 SASI_Mm02_00322014 predicted 1223
4 SASI_Mm02_00322015 predicted 1409
5 SASI_Mm01_00140913 predicted 1316
6 SASI_Mm02_00322016 predicted 1183
7 SASI_Mm02_00322017 predicted 1070
8 SASI_Mm01_00140914 predicted 657
9 SASI_Mm01_00140915 predicted 924
10 SASI_Mm01_00140917 predicted 840
11 SASI_Mm01_00140909 predicted 401
12 SASI_Mm01_00140910 predicted 394
13 SASI_Mm01_00140911 predicted 402
14 SASI_Mm01_00140912 predicted 1051
15 SASI_Mm01_00140916 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012046
VALIDATED
SPO11 MISSION shRNA Bacterial Glycerol Stock
SPO11 meiotic protein covalently bound to DSB
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012046.1-1372s1c1
Sequence:CCGGGCAAACTTCATAGTGCTCTTTCTCGAGAAAGAGCACTATGAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012046.1-658s1c1
Sequence:CCGGGCCGACTAACATTCAAGGAATCTCGAGATTCCTTGAATGTTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012046.1-1003s1c1
Sequence:CCGGCCAGAGGTTAAATATACCTAACTCGAGTTAGGTATATTTAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012046.1-559s1c1
Sequence:CCGGGCTATCTACTTCCAAGGGATTCTCGAGAATCCCTTGGAAGTAGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012046.1-250s1c1
Sequence:CCGGGCCTGCCTTCACAATAGACAACTCGAGTTGTCTATTGTGAAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012046.2-1323s21c1
Sequence:CCGGTCTTAGGTATGCAATGGTAAACTCGAGTTTACCATTGCATACCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012046.2-719s21c1
Sequence:CCGGGTCGAGAAGGATGCAACATTTCTCGAGAAATGTTGCATCCTTCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-1224s21c1
Sequence:CCGGGGTTTGGAGGATGGATCTAAACTCGAGTTTAGATCCATCCTCCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-443s21c1
Sequence:CCGGGCAACCAAGAGAGACATATACCTCGAGGTATATGTCTCTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-900s21c1
Sequence:CCGGTCGAGATAATGTGCATCTATACTCGAGTATAGATGCACATTATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012046
VALIDATED
SPO11 MISSION shRNA shRNA Plasmid DNA
SPO11 meiotic protein covalently bound to DSB
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012046.1-1372s1c1
Sequence:CCGGGCAAACTTCATAGTGCTCTTTCTCGAGAAAGAGCACTATGAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012046.1-658s1c1
Sequence:CCGGGCCGACTAACATTCAAGGAATCTCGAGATTCCTTGAATGTTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012046.1-1003s1c1
Sequence:CCGGCCAGAGGTTAAATATACCTAACTCGAGTTAGGTATATTTAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012046.1-559s1c1
Sequence:CCGGGCTATCTACTTCCAAGGGATTCTCGAGAATCCCTTGGAAGTAGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012046.1-250s1c1
Sequence:CCGGGCCTGCCTTCACAATAGACAACTCGAGTTGTCTATTGTGAAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012046.2-1323s21c1
Sequence:CCGGTCTTAGGTATGCAATGGTAAACTCGAGTTTACCATTGCATACCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012046.2-719s21c1
Sequence:CCGGGTCGAGAAGGATGCAACATTTCTCGAGAAATGTTGCATCCTTCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-1224s21c1
Sequence:CCGGGGTTTGGAGGATGGATCTAAACTCGAGTTTAGATCCATCCTCCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-443s21c1
Sequence:CCGGGCAACCAAGAGAGACATATACCTCGAGGTATATGTCTCTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-900s21c1
Sequence:CCGGTCGAGATAATGTGCATCTATACTCGAGTATAGATGCACATTATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012046
VALIDATED
SPO11 MISSION shRNA Lentiviral Transduction Particles
SPO11 meiotic protein covalently bound to DSB
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012046.1-1372s1c1
Sequence:CCGGGCAAACTTCATAGTGCTCTTTCTCGAGAAAGAGCACTATGAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012046.1-658s1c1
Sequence:CCGGGCCGACTAACATTCAAGGAATCTCGAGATTCCTTGAATGTTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012046.1-1003s1c1
Sequence:CCGGCCAGAGGTTAAATATACCTAACTCGAGTTAGGTATATTTAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012046.1-559s1c1
Sequence:CCGGGCTATCTACTTCCAAGGGATTCTCGAGAATCCCTTGGAAGTAGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012046.1-250s1c1
Sequence:CCGGGCCTGCCTTCACAATAGACAACTCGAGTTGTCTATTGTGAAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012046.2-1323s21c1
Sequence:CCGGTCTTAGGTATGCAATGGTAAACTCGAGTTTACCATTGCATACCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012046.2-719s21c1
Sequence:CCGGGTCGAGAAGGATGCAACATTTCTCGAGAAATGTTGCATCCTTCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-1224s21c1
Sequence:CCGGGGTTTGGAGGATGGATCTAAACTCGAGTTTAGATCCATCCTCCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-443s21c1
Sequence:CCGGGCAACCAAGAGAGACATATACCTCGAGGTATATGTCTCTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012046.2-900s21c1
Sequence:CCGGTCGAGATAATGTGCATCTATACTCGAGTATAGATGCACATTATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012444
SPO11 MISSION shRNA Bacterial Glycerol Stock
SPO11 meiotic protein covalently bound to DSB
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-953s1c1
Sequence:CCGGGCATCTATAAGTATGGATCTACTCGAGTAGATCCATACTTATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-281s1c1
Sequence:CCGGCAAGAAATGAAGCACCTGCATCTCGAGATGCAGGTGCTTCATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-784s1c1
Sequence:CCGGCGGCTCCTAGATGACAACTTTCTCGAGAAAGTTGTCATCTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-1241s1c1
Sequence:CCGGGAGTGTACTTACCTAACAAATCTCGAGATTTGTTAGGTAAGTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-703s1c1
Sequence:CCGGCCATCGAATATTCAAGGAATTCTCGAGAATTCCTTGAATATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012444
SPO11 MISSION shRNA shRNA Plasmid DNA
SPO11 meiotic protein covalently bound to DSB
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-953s1c1
Sequence:CCGGGCATCTATAAGTATGGATCTACTCGAGTAGATCCATACTTATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-281s1c1
Sequence:CCGGCAAGAAATGAAGCACCTGCATCTCGAGATGCAGGTGCTTCATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-784s1c1
Sequence:CCGGCGGCTCCTAGATGACAACTTTCTCGAGAAAGTTGTCATCTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-1241s1c1
Sequence:CCGGGAGTGTACTTACCTAACAAATCTCGAGATTTGTTAGGTAAGTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-703s1c1
Sequence:CCGGCCATCGAATATTCAAGGAATTCTCGAGAATTCCTTGAATATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012444
SPO11 MISSION shRNA Lentiviral Transduction Particles
SPO11 meiotic protein covalently bound to DSB
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-953s1c1
Sequence:CCGGGCATCTATAAGTATGGATCTACTCGAGTAGATCCATACTTATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-281s1c1
Sequence:CCGGCAAGAAATGAAGCACCTGCATCTCGAGATGCAGGTGCTTCATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-784s1c1
Sequence:CCGGCGGCTCCTAGATGACAACTTTCTCGAGAAAGTTGTCATCTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-1241s1c1
Sequence:CCGGGAGTGTACTTACCTAACAAATCTCGAGATTTGTTAGGTAAGTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012444.2-703s1c1
Sequence:CCGGCCATCGAATATTCAAGGAATTCTCGAGAATTCCTTGAATATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks