EMAIL THIS PAGE TO A FRIEND

SPOCD1

SPOC domain containing 1

Gene ID:
Mouse(622480) SPOC domain containing 1
Rat(313060) SPOC domain containing 1
Horse(100070425) SPOC domain containing 1
domestic cat(101101651) SPOC domain containing 1
dog(100683356) SPOC domain containing 1
domestic guinea pig(100731294) SPOC domain containing 1
naked mole-rat(101705783) SPOC domain containing 1
cow(511277) SPOC domain containing 1
sheep(101106499) SPOC domain containing 1
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001144949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001144949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001144949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151401 MISSION® esiRNA esiRNA human SPOCD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144569 Rosetta Predictions human pricing
XM_001061973 Rosetta Predictions rat pricing
XM_232779 Rosetta Predictions rat pricing
XM_886912 Rosetta Predictions mouse pricing
XM_910696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164664 predicted 722
2 SASI_Hs01_00164665 predicted 1454
3 SASI_Hs01_00164666 predicted 1372
4 SASI_Hs01_00164667 predicted 696
5 SASI_Hs01_00164668 predicted 2526
6 SASI_Hs01_00164669 predicted 2892
7 SASI_Hs01_00164670 predicted 1902
8 SASI_Hs01_00164671 predicted 1550
9 SASI_Hs01_00164672 predicted 1376
10 SASI_Hs01_00164673 predicted 2781
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301965 predicted 1051
2 SASI_Rn02_00301966 predicted 714
3 SASI_Rn02_00301967 predicted 209
4 SASI_Rn02_00301968 predicted 860
5 SASI_Rn02_00301969 predicted 2135
6 SASI_Rn02_00301970 predicted 803
7 SASI_Rn02_00301971 predicted 1745
8 SASI_Rn02_00301972 predicted 2124
9 SASI_Rn02_00301973 predicted 217
10 SASI_Rn02_00301974 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387235 predicted 750
2 SASI_Rn02_00387236 predicted 412
3 SASI_Rn02_00387237 predicted 735
4 SASI_Rn02_00387238 predicted 557
5 SASI_Rn02_00387239 predicted 1833
6 SASI_Rn02_00387240 predicted 498
7 SASI_Rn02_00387241 predicted 1440
8 SASI_Rn02_00387242 predicted 1822
9 SASI_Rn02_00387243 predicted 1172
10 SASI_Rn02_00387244 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428415 predicted 984
2 SASI_Mm02_00428416 predicted 1139
3 SASI_Mm02_00428417 predicted 1242
4 SASI_Mm02_00428418 predicted 1127
5 SASI_Mm02_00428419 predicted 926
6 SASI_Mm02_00428420 predicted 676
7 SASI_Mm02_00428421 predicted 680
8 SASI_Mm02_00428422 predicted 788
9 SASI_Mm02_00428423 predicted 1144
10 SASI_Mm02_00428424 predicted 1114
11 SASI_Mm01_00213355 predicted 1253
12 SASI_Mm01_00213356 predicted 1193
13 SASI_Mm01_00213357 predicted 1239
14 SASI_Mm01_00213358 predicted 1180
15 SASI_Mm01_00213359 predicted 1202
16 SASI_Mm01_00213360 predicted 1254
17 SASI_Mm01_00213361 predicted 1204
18 SASI_Mm01_00213362 predicted 1208
19 SASI_Mm01_00213363 predicted 1194
20 SASI_Mm01_00213364 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435835 predicted 1135
2 SASI_Mm02_00435836 predicted 930
3 SASI_Mm02_00435837 predicted 1128
4 SASI_Mm02_00435838 predicted 676
5 SASI_Mm02_00435839 predicted 1111
6 SASI_Mm02_00435840 predicted 516
7 SASI_Mm02_00435841 predicted 1024
8 SASI_Mm02_00435842 predicted 1201
9 SASI_Mm02_00435843 predicted 474
10 SASI_Mm02_00435844 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144569
SPOCD1 MISSION shRNA Bacterial Glycerol Stock
SPOC domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-1307s21c1
Sequence:CCGGAGAAGATCCAAGGGCACTAAGCTCGAGCTTAGTGCCCTTGGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2268s21c1
Sequence:CCGGACAAGGGCGAAGTGGAGATTCCTCGAGGAATCTCCACTTCGCCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2028s21c1
Sequence:CCGGGCCGGTACAAGACCAAGTATCCTCGAGGATACTTGGTCTTGTACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2397s21c1
Sequence:CCGGAGCATGACCACCACTTCTTAGCTCGAGCTAAGAAGTGGTGGTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-828s1c1
Sequence:CCGGCTGAATATCATTGAGCAGCAACTCGAGTTGCTGCTCAATGATATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-477s1c1
Sequence:CCGGGAGAAGCCATCCCTGTATATTCTCGAGAATATACAGGGATGGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-1511s1c1
Sequence:CCGGCCTGCTCTACTCATACCTCAACTCGAGTTGAGGTATGAGTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-1745s1c1
Sequence:CCGGGATGGTCTCCTTCAACAGTAACTCGAGTTACTGTTGAAGGAGACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-708s1c1
Sequence:CCGGGACTTGTTTCTCAAAGTGGTTCTCGAGAACCACTTTGAGAAACAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144569
SPOCD1 MISSION shRNA shRNA Plasmid DNA
SPOC domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-1307s21c1
Sequence:CCGGAGAAGATCCAAGGGCACTAAGCTCGAGCTTAGTGCCCTTGGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2268s21c1
Sequence:CCGGACAAGGGCGAAGTGGAGATTCCTCGAGGAATCTCCACTTCGCCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2028s21c1
Sequence:CCGGGCCGGTACAAGACCAAGTATCCTCGAGGATACTTGGTCTTGTACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2397s21c1
Sequence:CCGGAGCATGACCACCACTTCTTAGCTCGAGCTAAGAAGTGGTGGTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-828s1c1
Sequence:CCGGCTGAATATCATTGAGCAGCAACTCGAGTTGCTGCTCAATGATATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-477s1c1
Sequence:CCGGGAGAAGCCATCCCTGTATATTCTCGAGAATATACAGGGATGGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-1511s1c1
Sequence:CCGGCCTGCTCTACTCATACCTCAACTCGAGTTGAGGTATGAGTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-1745s1c1
Sequence:CCGGGATGGTCTCCTTCAACAGTAACTCGAGTTACTGTTGAAGGAGACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-708s1c1
Sequence:CCGGGACTTGTTTCTCAAAGTGGTTCTCGAGAACCACTTTGAGAAACAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144569
SPOCD1 MISSION shRNA Lentiviral Transduction Particles
SPOC domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-1307s21c1
Sequence:CCGGAGAAGATCCAAGGGCACTAAGCTCGAGCTTAGTGCCCTTGGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2268s21c1
Sequence:CCGGACAAGGGCGAAGTGGAGATTCCTCGAGGAATCTCCACTTCGCCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2028s21c1
Sequence:CCGGGCCGGTACAAGACCAAGTATCCTCGAGGATACTTGGTCTTGTACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144569.4-2397s21c1
Sequence:CCGGAGCATGACCACCACTTCTTAGCTCGAGCTAAGAAGTGGTGGTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-828s1c1
Sequence:CCGGCTGAATATCATTGAGCAGCAACTCGAGTTGCTGCTCAATGATATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-477s1c1
Sequence:CCGGGAGAAGCCATCCCTGTATATTCTCGAGAATATACAGGGATGGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-1511s1c1
Sequence:CCGGCCTGCTCTACTCATACCTCAACTCGAGTTGAGGTATGAGTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-1745s1c1
Sequence:CCGGGATGGTCTCCTTCAACAGTAACTCGAGTTACTGTTGAAGGAGACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144569.2-708s1c1
Sequence:CCGGGACTTGTTTCTCAAAGTGGTTCTCGAGAACCACTTTGAGAAACAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144949
SPOCD1 MISSION shRNA Bacterial Glycerol Stock
SPOC domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-238s21c1
Sequence:CCGGCTGGTACAGATGAGCTCAATCCTCGAGGATTGAGCTCATCTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-305s21c1
Sequence:CCGGGAAAGGGCCTGGACATCATTGCTCGAGCAATGATGTCCAGGCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-547s21c1
Sequence:CCGGGATCGGAAATCCTCAACTAAACTCGAGTTTAGTTGAGGATTTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-1136s21c1
Sequence:CCGGTGTTACTAGCTGTACTATTTCCTCGAGGAAATAGTACAGCTAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-519s21c1
Sequence:CCGGATGTGACTCTAACTGTCAAATCTCGAGATTTGACAGTTAGAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144949
SPOCD1 MISSION shRNA shRNA Plasmid DNA
SPOC domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-238s21c1
Sequence:CCGGCTGGTACAGATGAGCTCAATCCTCGAGGATTGAGCTCATCTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-305s21c1
Sequence:CCGGGAAAGGGCCTGGACATCATTGCTCGAGCAATGATGTCCAGGCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-547s21c1
Sequence:CCGGGATCGGAAATCCTCAACTAAACTCGAGTTTAGTTGAGGATTTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-1136s21c1
Sequence:CCGGTGTTACTAGCTGTACTATTTCCTCGAGGAAATAGTACAGCTAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-519s21c1
Sequence:CCGGATGTGACTCTAACTGTCAAATCTCGAGATTTGACAGTTAGAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144949
SPOCD1 MISSION shRNA Lentiviral Transduction Particles
SPOC domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-238s21c1
Sequence:CCGGCTGGTACAGATGAGCTCAATCCTCGAGGATTGAGCTCATCTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-305s21c1
Sequence:CCGGGAAAGGGCCTGGACATCATTGCTCGAGCAATGATGTCCAGGCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-547s21c1
Sequence:CCGGGATCGGAAATCCTCAACTAAACTCGAGTTTAGTTGAGGATTTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-1136s21c1
Sequence:CCGGTGTTACTAGCTGTACTATTTCCTCGAGGAAATAGTACAGCTAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144949.1-519s21c1
Sequence:CCGGATGTGACTCTAACTGTCAAATCTCGAGATTTGACAGTTAGAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks