EMAIL THIS PAGE TO A FRIEND

SPOCK1

sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1

Synonyms: SPOCK TESTICAN TIC1
UniProtKB ID: Q08629, B3KSW3, Q59EW0, Q8N630, Q9UCL8
Gene ID:
Human(6695) Summary: This gene encodes the protein core of a seminal plasma proteoglycan containing chondroitin- and heparan-sulfate chains. The protein's function is unknown, although similarity to thyropin-type cysteine protease-inhibitors suggests its function may be related to protease inhibition. [provided by RefSeq, Jul 2008]
Mouse(20745) sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1
Rat(306759) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
chicken(416304) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
domestic cat(101088716) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Horse(100072653) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
dog(474688) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
cow(511211) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
sheep(101120081) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
naked mole-rat(101701044) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Domestic Rabbit(100342871) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
domestic guinea pig(100732307) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
224 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004598 Rosetta Predictions human pricing
XM_001067546 Rosetta Predictions rat pricing
XM_225160 Rosetta Predictions rat pricing
NM_009262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033149 predicted 1101
2 SASI_Hs01_00033150 predicted 959
3 SASI_Hs01_00033151 predicted 612
4 SASI_Hs02_00337969 predicted 628
5 SASI_Hs01_00033152 predicted 308
6 SASI_Hs01_00033154 predicted 1145
7 SASI_Hs01_00033155 predicted 1154
8 SASI_Hs01_00033156 predicted 321
9 SASI_Hs01_00033157 predicted 533
10 SASI_Hs01_00033158 predicted 739
11 SASI_Hs01_00033153 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321342 predicted 1218
2 SASI_Rn02_00321343 predicted 1407
3 SASI_Rn02_00321344 predicted 889
4 SASI_Rn02_00321345 predicted 1294
5 SASI_Rn02_00321346 predicted 1366
6 SASI_Rn02_00321347 predicted 1405
7 SASI_Rn02_00321348 predicted 1113
8 SASI_Rn02_00321349 predicted 1243
9 SASI_Rn02_00321350 predicted 803
10 SASI_Rn02_00321351 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382567 predicted 399
2 SASI_Rn02_00382568 predicted 272
3 SASI_Rn02_00382569 predicted 999
4 SASI_Rn02_00382570 predicted 480
5 SASI_Rn02_00382571 predicted 952
6 SASI_Rn02_00382572 predicted 1005
7 SASI_Rn02_00382573 predicted 411
8 SASI_Rn02_00382574 predicted 222
9 SASI_Rn02_00382575 predicted 236
10 SASI_Rn02_00382576 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087870 predicted 1080
2 SASI_Mm01_00087871 predicted 975
3 SASI_Mm01_00087872 predicted 1438
4 SASI_Mm01_00087873 predicted 570
5 SASI_Mm01_00087874 predicted 1099
6 SASI_Mm01_00087875 predicted 898
7 SASI_Mm02_00315746 predicted 1494
8 SASI_Mm01_00087876 predicted 924
9 SASI_Mm01_00087878 predicted 480
10 SASI_Mm01_00087879 predicted 993
11 SASI_Mm01_00087877 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004598
VALIDATED
SPOCK1 MISSION shRNA Bacterial Glycerol Stock
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-230s1c1
Sequence:CCGGCCACGGCAATTTCCTAGACAACTCGAGTTGTCTAGGAAATTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004598.2-304s1c1
Sequence:CCGGGCTTTCGAGACGATGATTATTCTCGAGAATAATCATCGTCTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-923s1c1
Sequence:CCGGCCCTTCAGAGATCAATGCCATCTCGAGATGGCATTGATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-1308s1c1
Sequence:CCGGCTGCTGGATGACCTAGAATATCTCGAGATATTCTAGGTCATCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-1134s1c1
Sequence:CCGGCGGTGTAATGAGGAGGGCTATCTCGAGATAGCCCTCCTCATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004598.3-1446s21c1
Sequence:CCGGAGGATGAGGTCGGGTACATATCTCGAGATATGTACCCGACCTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004598.3-1834s21c1
Sequence:CCGGACCCACACTGGTGGTTATTACCTCGAGGTAATAACCACCAGTGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004598.3-1507s21c1
Sequence:CCGGATTGCAAGTCACTTCCTATTCCTCGAGGAATAGGAAGTGACTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004598
VALIDATED
SPOCK1 MISSION shRNA shRNA Plasmid DNA
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-230s1c1
Sequence:CCGGCCACGGCAATTTCCTAGACAACTCGAGTTGTCTAGGAAATTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004598.2-304s1c1
Sequence:CCGGGCTTTCGAGACGATGATTATTCTCGAGAATAATCATCGTCTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-923s1c1
Sequence:CCGGCCCTTCAGAGATCAATGCCATCTCGAGATGGCATTGATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-1308s1c1
Sequence:CCGGCTGCTGGATGACCTAGAATATCTCGAGATATTCTAGGTCATCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-1134s1c1
Sequence:CCGGCGGTGTAATGAGGAGGGCTATCTCGAGATAGCCCTCCTCATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004598.3-1446s21c1
Sequence:CCGGAGGATGAGGTCGGGTACATATCTCGAGATATGTACCCGACCTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004598.3-1834s21c1
Sequence:CCGGACCCACACTGGTGGTTATTACCTCGAGGTAATAACCACCAGTGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004598.3-1507s21c1
Sequence:CCGGATTGCAAGTCACTTCCTATTCCTCGAGGAATAGGAAGTGACTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004598
VALIDATED
SPOCK1 MISSION shRNA Lentiviral Transduction Particles
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-230s1c1
Sequence:CCGGCCACGGCAATTTCCTAGACAACTCGAGTTGTCTAGGAAATTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_004598.2-304s1c1
Sequence:CCGGGCTTTCGAGACGATGATTATTCTCGAGAATAATCATCGTCTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-923s1c1
Sequence:CCGGCCCTTCAGAGATCAATGCCATCTCGAGATGGCATTGATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-1308s1c1
Sequence:CCGGCTGCTGGATGACCTAGAATATCTCGAGATATTCTAGGTCATCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004598.2-1134s1c1
Sequence:CCGGCGGTGTAATGAGGAGGGCTATCTCGAGATAGCCCTCCTCATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004598.3-1446s21c1
Sequence:CCGGAGGATGAGGTCGGGTACATATCTCGAGATATGTACCCGACCTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004598.3-1834s21c1
Sequence:CCGGACCCACACTGGTGGTTATTACCTCGAGGTAATAACCACCAGTGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004598.3-1507s21c1
Sequence:CCGGATTGCAAGTCACTTCCTATTCCTCGAGGAATAGGAAGTGACTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009262
SPOCK1 MISSION shRNA Bacterial Glycerol Stock
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-953s1c1
Sequence:CCGGGCCATCTACCTAGACAAATATCTCGAGATATTTGTCTAGGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-235s1c1
Sequence:CCGGCAACGCCAATTTCCTAGACAACTCGAGTTGTCTAGGAAATTGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-1436s1c1
Sequence:CCGGGAAGATGAGGTCGGCTACATACTCGAGTATGTAGCCGACCTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-937s1c1
Sequence:CCGGCCACTCAGAGATCAATGCCATCTCGAGATGGCATTGATCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-1075s1c1
Sequence:CCGGCCCTTGCCAGAATGAAATGAACTCGAGTTCATTTCATTCTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009262
SPOCK1 MISSION shRNA shRNA Plasmid DNA
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-953s1c1
Sequence:CCGGGCCATCTACCTAGACAAATATCTCGAGATATTTGTCTAGGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-235s1c1
Sequence:CCGGCAACGCCAATTTCCTAGACAACTCGAGTTGTCTAGGAAATTGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-1436s1c1
Sequence:CCGGGAAGATGAGGTCGGCTACATACTCGAGTATGTAGCCGACCTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-937s1c1
Sequence:CCGGCCACTCAGAGATCAATGCCATCTCGAGATGGCATTGATCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-1075s1c1
Sequence:CCGGCCCTTGCCAGAATGAAATGAACTCGAGTTCATTTCATTCTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009262
SPOCK1 MISSION shRNA Lentiviral Transduction Particles
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-953s1c1
Sequence:CCGGGCCATCTACCTAGACAAATATCTCGAGATATTTGTCTAGGTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-235s1c1
Sequence:CCGGCAACGCCAATTTCCTAGACAACTCGAGTTGTCTAGGAAATTGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-1436s1c1
Sequence:CCGGGAAGATGAGGTCGGCTACATACTCGAGTATGTAGCCGACCTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-937s1c1
Sequence:CCGGCCACTCAGAGATCAATGCCATCTCGAGATGGCATTGATCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009262.1-1075s1c1
Sequence:CCGGCCCTTGCCAGAATGAAATGAACTCGAGTTCATTTCATTCTGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks