EMAIL THIS PAGE TO A FRIEND

SPOCK2

sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2

Synonyms: testican-2
UniProtKB ID: Q92563, C9J767, Q6UW87
Gene ID:
Human(9806) Summary: This gene encodes a protein which binds with glycosaminoglycans to form part of the extracellular matrix. The protein contains thyroglobulin type-1, follistatin-like, and calcium-binding domains, and has glycosaminoglycan attachment sites in the acidic C-terminal region. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(94214) sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2
Rat(361840) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
domestic guinea pig(100713951) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
naked mole-rat(101725003) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
cow(523846) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
sheep(101113125) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
Zebrafish(100320541) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
Horse(100063582) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
domestic cat(101096606) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
dog(489037) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
158 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014767 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_052994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_052994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_052994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014767 Rosetta Predictions human pricing
NM_001108533 Rosetta Predictions rat pricing
NM_052994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214121 predicted 768
2 SASI_Hs01_00214122 predicted 1057
3 SASI_Hs01_00214123 predicted 639
4 SASI_Hs01_00214125 predicted 436
5 SASI_Hs02_00346257 predicted 742
6 SASI_Hs01_00214126 predicted 899
7 SASI_Hs01_00214127 predicted 2082
8 SASI_Hs01_00214128 predicted 469
9 SASI_Hs01_00214130 predicted 459
10 SASI_Hs02_00346258 predicted 1202
11 SASI_Hs01_00214124 predicted 1133
12 SASI_Hs01_00214129 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239579 predicted 953
2 SASI_Rn02_00239580 predicted 661
3 SASI_Rn02_00239581 predicted 626
4 SASI_Rn02_00239582 predicted 434
5 SASI_Rn02_00239583 predicted 740
6 SASI_Rn02_00239584 predicted 864
7 SASI_Rn02_00239585 predicted 417
8 SASI_Rn02_00239586 predicted 592
9 SASI_Rn02_00239587 predicted 1104
10 SASI_Rn02_00239588 predicted 2039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201256 predicted 348
2 SASI_Mm01_00201257 predicted 770
3 SASI_Mm01_00201259 predicted 428
4 SASI_Mm01_00201260 predicted 1013
5 SASI_Mm01_00201261 predicted 421
6 SASI_Mm01_00201262 predicted 542
7 SASI_Mm01_00201263 predicted 1101
8 SASI_Mm01_00201264 predicted 353
9 SASI_Mm02_00337511 predicted 989
10 SASI_Mm01_00201265 predicted 441
11 SASI_Mm01_00201258 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014767
SPOCK2 MISSION shRNA Bacterial Glycerol Stock
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014767.2-517s21c1
Sequence:CCGGCGAAGTGGAGGATGACTATATCTCGAGATATAGTCATCCTCCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014767.2-1668s21c1
Sequence:CCGGTTCGAGAACGGATCCAGAAATCTCGAGATTTCTGGATCCGTTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014767.2-1821s21c1
Sequence:CCGGGTGTGGCATGCGCTGACAAATCTCGAGATTTGTCAGCGCATGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-1294s1c2
Sequence:CCGGCAAGAAGAAGCCAGGCATCTTCTCGAGAAGATGCCTGGCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-643s1c2
Sequence:CCGGCATGTGCATCAGTCGCAAGAACTCGAGTTCTTGCGACTGATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-536s1c1
Sequence:CCGGGAGGACAATCAGCAAGGAGATCTCGAGATCTCCTTGCTGATTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-700s1c1
Sequence:CCGGCCATGGAAACAAAGACTCCATCTCGAGATGGAGTCTTTGTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-891s1c1
Sequence:CCGGCCGATGGCAAACCAGAGACTTCTCGAGAAGTCTCTGGTTTGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-1294s1c1
Sequence:CCGGCAAGAAGAAGCCAGGCATCTTCTCGAGAAGATGCCTGGCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-643s1c1
Sequence:CCGGCATGTGCATCAGTCGCAAGAACTCGAGTTCTTGCGACTGATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014767
SPOCK2 MISSION shRNA shRNA Plasmid DNA
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014767.2-517s21c1
Sequence:CCGGCGAAGTGGAGGATGACTATATCTCGAGATATAGTCATCCTCCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014767.2-1668s21c1
Sequence:CCGGTTCGAGAACGGATCCAGAAATCTCGAGATTTCTGGATCCGTTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014767.2-1821s21c1
Sequence:CCGGGTGTGGCATGCGCTGACAAATCTCGAGATTTGTCAGCGCATGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-1294s1c2
Sequence:CCGGCAAGAAGAAGCCAGGCATCTTCTCGAGAAGATGCCTGGCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-643s1c2
Sequence:CCGGCATGTGCATCAGTCGCAAGAACTCGAGTTCTTGCGACTGATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-536s1c1
Sequence:CCGGGAGGACAATCAGCAAGGAGATCTCGAGATCTCCTTGCTGATTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-700s1c1
Sequence:CCGGCCATGGAAACAAAGACTCCATCTCGAGATGGAGTCTTTGTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-891s1c1
Sequence:CCGGCCGATGGCAAACCAGAGACTTCTCGAGAAGTCTCTGGTTTGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-1294s1c1
Sequence:CCGGCAAGAAGAAGCCAGGCATCTTCTCGAGAAGATGCCTGGCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-643s1c1
Sequence:CCGGCATGTGCATCAGTCGCAAGAACTCGAGTTCTTGCGACTGATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014767
SPOCK2 MISSION shRNA Lentiviral Transduction Particles
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014767.2-517s21c1
Sequence:CCGGCGAAGTGGAGGATGACTATATCTCGAGATATAGTCATCCTCCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014767.2-1668s21c1
Sequence:CCGGTTCGAGAACGGATCCAGAAATCTCGAGATTTCTGGATCCGTTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014767.2-1821s21c1
Sequence:CCGGGTGTGGCATGCGCTGACAAATCTCGAGATTTGTCAGCGCATGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-1294s1c2
Sequence:CCGGCAAGAAGAAGCCAGGCATCTTCTCGAGAAGATGCCTGGCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-643s1c2
Sequence:CCGGCATGTGCATCAGTCGCAAGAACTCGAGTTCTTGCGACTGATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-536s1c1
Sequence:CCGGGAGGACAATCAGCAAGGAGATCTCGAGATCTCCTTGCTGATTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-700s1c1
Sequence:CCGGCCATGGAAACAAAGACTCCATCTCGAGATGGAGTCTTTGTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-891s1c1
Sequence:CCGGCCGATGGCAAACCAGAGACTTCTCGAGAAGTCTCTGGTTTGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-1294s1c1
Sequence:CCGGCAAGAAGAAGCCAGGCATCTTCTCGAGAAGATGCCTGGCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014767.1-643s1c1
Sequence:CCGGCATGTGCATCAGTCGCAAGAACTCGAGTTCTTGCGACTGATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052994
SPOCK2 MISSION shRNA Bacterial Glycerol Stock
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052994.2-2268s1c1
Sequence:CCGGCCCTGATAGATTATCTCTCAACTCGAGTTGAGAGATAATCTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-1333s1c1
Sequence:CCGGCTGTGATGACATCGTGGGTTTCTCGAGAAACCCACGATGTCATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-1063s1c1
Sequence:CCGGCTTCAACTCCTGTGATACCTACTCGAGTAGGTATCACAGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-367s1c1
Sequence:CCGGCGGCAAGATTAAGCACTGGAACTCGAGTTCCAGTGCTTAATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-954s1c1
Sequence:CCGGCCATCGGTTGGATGTTCTCTACTCGAGTAGAGAACATCCAACCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052994
SPOCK2 MISSION shRNA shRNA Plasmid DNA
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052994.2-2268s1c1
Sequence:CCGGCCCTGATAGATTATCTCTCAACTCGAGTTGAGAGATAATCTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-1333s1c1
Sequence:CCGGCTGTGATGACATCGTGGGTTTCTCGAGAAACCCACGATGTCATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-1063s1c1
Sequence:CCGGCTTCAACTCCTGTGATACCTACTCGAGTAGGTATCACAGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-367s1c1
Sequence:CCGGCGGCAAGATTAAGCACTGGAACTCGAGTTCCAGTGCTTAATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-954s1c1
Sequence:CCGGCCATCGGTTGGATGTTCTCTACTCGAGTAGAGAACATCCAACCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052994
SPOCK2 MISSION shRNA Lentiviral Transduction Particles
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052994.2-2268s1c1
Sequence:CCGGCCCTGATAGATTATCTCTCAACTCGAGTTGAGAGATAATCTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-1333s1c1
Sequence:CCGGCTGTGATGACATCGTGGGTTTCTCGAGAAACCCACGATGTCATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-1063s1c1
Sequence:CCGGCTTCAACTCCTGTGATACCTACTCGAGTAGGTATCACAGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-367s1c1
Sequence:CCGGCGGCAAGATTAAGCACTGGAACTCGAGTTCCAGTGCTTAATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052994.2-954s1c1
Sequence:CCGGCCATCGGTTGGATGTTCTCTACTCGAGTAGAGAACATCCAACCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks