EMAIL THIS PAGE TO A FRIEND

SPOCK3

sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3

Synonyms: HSAJ1454 TES-3 TICN3
Gene ID:
Human(50859) Summary: This gene encodes a member of a novel family of calcium-binding proteoglycan proteins that contain thyroglobulin type-1 and Kazal-like domains. The encoded protein and may play a role in adult T-cell leukemia by inhibiting the activity of membrane-type matrix metalloproteinases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Mouse(72902) sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Rat(306404) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Zebrafish(562002) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Horse(100067749) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
domestic cat(101095008) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
dog(482676) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
chicken(422425) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
naked mole-rat(101717685) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
domestic guinea pig(100722783) sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060281 MISSION® esiRNA esiRNA human SPOCK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040159 Rosetta Predictions human pricing
NM_016950 Rosetta Predictions human pricing
NM_001107310 Rosetta Predictions rat pricing
NM_023689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153225 predicted 1011
2 SASI_Hs01_00153226 predicted 667
3 SASI_Hs01_00153228 predicted 654
4 SASI_Hs01_00153229 predicted 904
5 SASI_Hs01_00153230 predicted 700
6 SASI_Hs01_00153231 predicted 948
7 SASI_Hs01_00153233 predicted 889
8 SASI_Hs02_00308865 predicted 951
9 SASI_Hs02_00308866 predicted 896
10 SASI_Hs02_00308867 predicted 1008
11 SASI_Hs01_00153227 predicted 837
12 SASI_Hs01_00153232 predicted 1021
13 SASI_Hs01_00153234 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031888 predicted 1012
2 SASI_Hs01_00031889 predicted 681
3 SASI_Hs01_00031891 predicted 664
4 SASI_Hs01_00031892 predicted 914
5 SASI_Hs01_00031893 predicted 709
6 SASI_Hs01_00031894 predicted 963
7 SASI_Hs01_00031896 predicted 900
8 SASI_Hs02_00349953 predicted 959
9 SASI_Hs02_00349954 predicted 901
10 SASI_Hs02_00349955 predicted 1016
11 SASI_Hs01_00031890 predicted 854
12 SASI_Hs01_00031895 predicted 1035
13 SASI_Hs01_00031897 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227575 predicted 884
2 SASI_Rn02_00227576 predicted 924
3 SASI_Rn02_00227577 predicted 839
4 SASI_Rn02_00227578 predicted 1025
5 SASI_Rn02_00227579 predicted 954
6 SASI_Rn02_00227580 predicted 904
7 SASI_Rn02_00227581 predicted 745
8 SASI_Rn02_00227582 predicted 1014
9 SASI_Rn02_00227583 predicted 296
10 SASI_Rn02_00227584 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085761 predicted 785
2 SASI_Mm01_00085762 predicted 831
3 SASI_Mm01_00085763 predicted 898
4 SASI_Mm01_00085764 predicted 961
5 SASI_Mm01_00085765 predicted 649
6 SASI_Mm01_00085767 predicted 257
7 SASI_Mm01_00085768 predicted 845
8 SASI_Mm01_00085769 predicted 331
9 SASI_Mm01_00085770 predicted 858
10 SASI_Mm02_00327297 predicted 401
11 SASI_Mm01_00085766 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016950
SPOCK3 MISSION shRNA Bacterial Glycerol Stock
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-693s1c1
Sequence:CCGGCCAGTACAAGCAGAAATGTTACTCGAGTAACATTTCTGCTTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-353s1c1
Sequence:CCGGCCCTTCGATCAGGCTTTAGATCTCGAGATCTAAAGCCTGATCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-253s1c1
Sequence:CCGGGCTCACCACAATCTCTCAGTACTCGAGTACTGAGAGATTGTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-1326s1c1
Sequence:CCGGAGGATGATGAAGACGATATTACTCGAGTAATATCGTCTTCATCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-844s1c1
Sequence:CCGGCGATACCAGCATCTTGCCAATCTCGAGATTGGCAAGATGCTGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016950.2-329s21c1
Sequence:CCGGACGAAGTAGAGGATGATTATTCTCGAGAATAATCATCCTCTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016950.2-418s21c1
Sequence:CCGGATGAAATGTAGTCGCCATAAACTCGAGTTTATGGCGACTACATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016950.2-1545s21c1
Sequence:CCGGGATTCTAAACCTCACATATATCTCGAGATATATGTGAGGTTTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016950
SPOCK3 MISSION shRNA shRNA Plasmid DNA
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-693s1c1
Sequence:CCGGCCAGTACAAGCAGAAATGTTACTCGAGTAACATTTCTGCTTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-353s1c1
Sequence:CCGGCCCTTCGATCAGGCTTTAGATCTCGAGATCTAAAGCCTGATCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-253s1c1
Sequence:CCGGGCTCACCACAATCTCTCAGTACTCGAGTACTGAGAGATTGTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-1326s1c1
Sequence:CCGGAGGATGATGAAGACGATATTACTCGAGTAATATCGTCTTCATCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-844s1c1
Sequence:CCGGCGATACCAGCATCTTGCCAATCTCGAGATTGGCAAGATGCTGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016950.2-329s21c1
Sequence:CCGGACGAAGTAGAGGATGATTATTCTCGAGAATAATCATCCTCTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016950.2-418s21c1
Sequence:CCGGATGAAATGTAGTCGCCATAAACTCGAGTTTATGGCGACTACATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016950.2-1545s21c1
Sequence:CCGGGATTCTAAACCTCACATATATCTCGAGATATATGTGAGGTTTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016950
SPOCK3 MISSION shRNA Lentiviral Transduction Particles
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-693s1c1
Sequence:CCGGCCAGTACAAGCAGAAATGTTACTCGAGTAACATTTCTGCTTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-353s1c1
Sequence:CCGGCCCTTCGATCAGGCTTTAGATCTCGAGATCTAAAGCCTGATCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-253s1c1
Sequence:CCGGGCTCACCACAATCTCTCAGTACTCGAGTACTGAGAGATTGTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-1326s1c1
Sequence:CCGGAGGATGATGAAGACGATATTACTCGAGTAATATCGTCTTCATCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016950.1-844s1c1
Sequence:CCGGCGATACCAGCATCTTGCCAATCTCGAGATTGGCAAGATGCTGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016950.2-329s21c1
Sequence:CCGGACGAAGTAGAGGATGATTATTCTCGAGAATAATCATCCTCTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016950.2-418s21c1
Sequence:CCGGATGAAATGTAGTCGCCATAAACTCGAGTTTATGGCGACTACATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016950.2-1545s21c1
Sequence:CCGGGATTCTAAACCTCACATATATCTCGAGATATATGTGAGGTTTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023689
SPOCK3 MISSION shRNA Bacterial Glycerol Stock
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023689.2-1473s1c1
Sequence:CCGGCCCTAAACAAAGTGGTTCTAACTCGAGTTAGAACCACTTTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-900s1c1
Sequence:CCGGCTTGGGAGCATATACCTTGATCTCGAGATCAAGGTATATGCTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-369s1c1
Sequence:CCGGAGCCGCCACAAAGTTTGCATTCTCGAGAATGCAAACTTTGTGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-568s1c1
Sequence:CCGGGCAAACTAGAATATCAGGCATCTCGAGATGCCTGATATTCTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-215s1c1
Sequence:CCGGGCTCACGACAATCTCTCAGTACTCGAGTACTGAGAGATTGTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023689.2-1852s21c1
Sequence:CCGGCAAGACTTATAGTTGGTATTTCTCGAGAAATACCAACTATAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-346s21c1
Sequence:CCGGACCCATGCTTAAAGACGAAATCTCGAGATTTCGTCTTTAAGCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-271s21c1
Sequence:CCGGACGAAGTAGAGGATGATTATTCTCGAGAATAATCATCCTCTACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-1371s21c1
Sequence:CCGGGATGTCCATGATGGATATATTCTCGAGAATATATCCATCATGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023689
SPOCK3 MISSION shRNA shRNA Plasmid DNA
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023689.2-1473s1c1
Sequence:CCGGCCCTAAACAAAGTGGTTCTAACTCGAGTTAGAACCACTTTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-900s1c1
Sequence:CCGGCTTGGGAGCATATACCTTGATCTCGAGATCAAGGTATATGCTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-369s1c1
Sequence:CCGGAGCCGCCACAAAGTTTGCATTCTCGAGAATGCAAACTTTGTGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-568s1c1
Sequence:CCGGGCAAACTAGAATATCAGGCATCTCGAGATGCCTGATATTCTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-215s1c1
Sequence:CCGGGCTCACGACAATCTCTCAGTACTCGAGTACTGAGAGATTGTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023689.2-1852s21c1
Sequence:CCGGCAAGACTTATAGTTGGTATTTCTCGAGAAATACCAACTATAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-346s21c1
Sequence:CCGGACCCATGCTTAAAGACGAAATCTCGAGATTTCGTCTTTAAGCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-271s21c1
Sequence:CCGGACGAAGTAGAGGATGATTATTCTCGAGAATAATCATCCTCTACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-1371s21c1
Sequence:CCGGGATGTCCATGATGGATATATTCTCGAGAATATATCCATCATGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023689
SPOCK3 MISSION shRNA Lentiviral Transduction Particles
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023689.2-1473s1c1
Sequence:CCGGCCCTAAACAAAGTGGTTCTAACTCGAGTTAGAACCACTTTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-900s1c1
Sequence:CCGGCTTGGGAGCATATACCTTGATCTCGAGATCAAGGTATATGCTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-369s1c1
Sequence:CCGGAGCCGCCACAAAGTTTGCATTCTCGAGAATGCAAACTTTGTGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-568s1c1
Sequence:CCGGGCAAACTAGAATATCAGGCATCTCGAGATGCCTGATATTCTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023689.2-215s1c1
Sequence:CCGGGCTCACGACAATCTCTCAGTACTCGAGTACTGAGAGATTGTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023689.2-1852s21c1
Sequence:CCGGCAAGACTTATAGTTGGTATTTCTCGAGAAATACCAACTATAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-346s21c1
Sequence:CCGGACCCATGCTTAAAGACGAAATCTCGAGATTTCGTCTTTAAGCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-271s21c1
Sequence:CCGGACGAAGTAGAGGATGATTATTCTCGAGAATAATCATCCTCTACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023689.2-1371s21c1
Sequence:CCGGGATGTCCATGATGGATATATTCTCGAGAATATATCCATCATGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks