EMAIL THIS PAGE TO A FRIEND

SPON1

spondin 1, extracellular matrix protein

Synonyms: VSGP/F-spondin f-spondin
UniProtKB ID: Q9HCB6, A8K6W5, O94862, Q8NCD7, Q8WUR5
Gene ID:
Mouse(233744) spondin 1, (f-spondin) extracellular matrix protein
Rat(64456) spondin 1, extracellular matrix protein
chicken(395657) spondin 1, extracellular matrix protein
domestic cat(101094373) spondin 1, extracellular matrix protein
dog(476864) spondin 1, extracellular matrix protein
domestic guinea pig(100714375) spondin 1, extracellular matrix protein
naked mole-rat(101722320) spondin 1, extracellular matrix protein
cow(282866) spondin 1, extracellular matrix protein
sheep(101118982) spondin 1, extracellular matrix protein
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006108 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024101 MISSION® esiRNA esiRNA human SPON1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006108 Rosetta Predictions human pricing
NM_172067 Rosetta Predictions rat pricing
XM_579693 Rosetta Predictions rat pricing
NM_145584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340896 predicted 1794
2 SASI_Hs02_00340897 predicted 1147
3 SASI_Hs01_00125714 predicted 1450
4 SASI_Hs02_00340898 predicted 892
5 SASI_Hs02_00340899 predicted 1104
6 SASI_Hs02_00340900 predicted 1312
7 SASI_Hs02_00340901 predicted 885
8 SASI_Hs02_00340902 predicted 912
9 SASI_Hs02_00340903 predicted 1284
10 SASI_Hs02_00340904 predicted 1620
11 SASI_Hs01_00125715 predicted 489
12 SASI_Hs01_00125716 predicted 831
13 SASI_Hs01_00125717 predicted 2581
14 SASI_Hs01_00125718 predicted 2512
15 SASI_Hs01_00125719 predicted 1447
16 SASI_Hs01_00125720 predicted 750
17 SASI_Hs01_00125721 predicted 1206
18 SASI_Hs01_00125722 predicted 2531
19 SASI_Hs01_00125723 predicted 2542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035481 predicted 1250
2 SASI_Rn01_00035482 predicted 2285
3 SASI_Rn01_00035483 predicted 1479
4 SASI_Rn01_00035485 predicted 708
5 SASI_Rn01_00035486 predicted 2702
6 SASI_Rn01_00035487 predicted 503
7 SASI_Rn01_00035488 predicted 903
8 SASI_Rn01_00035489 predicted 1849
9 SASI_Rn01_00035490 predicted 2008
10 SASI_Rn02_00269169 predicted 2691
11 SASI_Rn01_00035484 predicted 2594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127704 predicted 1475
2 SASI_Rn01_00127705 predicted 1454
3 SASI_Rn01_00127706 predicted 1373
4 SASI_Rn01_00127707 predicted 1487
5 SASI_Rn01_00127708 predicted 1379
6 SASI_Rn01_00127709 predicted 2016
7 SASI_Rn01_00127710 predicted 2510
8 SASI_Rn01_00127711 predicted 1432
9 SASI_Rn01_00127712 predicted 1315
10 SASI_Rn01_00127713 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109023 predicted 1447
2 SASI_Mm01_00109025 predicted 682
3 SASI_Mm01_00109026 predicted 475
4 SASI_Mm01_00109027 predicted 864
5 SASI_Mm01_00109028 predicted 808
6 SASI_Mm02_00341120 predicted 2227
7 SASI_Mm01_00109030 predicted 1991
8 SASI_Mm01_00109031 predicted 732
9 SASI_Mm02_00341121 predicted 459
10 SASI_Mm01_00109032 predicted 1419
11 SASI_Mm01_00109024 predicted 2264
12 SASI_Mm01_00109029 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006108
VALIDATED
SPON1 MISSION shRNA Bacterial Glycerol Stock
spondin 1, extracellular matrix protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006108.2-3014s21c1
Sequence:CCGGGCTGGATTATTTGCTTGTTTACTCGAGTAAACAAGCAAATAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1793s21c1
Sequence:CCGGCCTGACAATGTCGATGATATTCTCGAGAATATCATCGACATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1741s21c1
Sequence:CCGGCAGAGTTGTCATCGAGAGAATCTCGAGATTCTCTCGATGACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1151s21c1
Sequence:CCGGGCCAAGTACAGACTCACATTTCTCGAGAAATGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006108.1-2690s1c1
Sequence:CCGGGCTGGATTATTTGCTTGTTTACTCGAGTAAACAAGCAAATAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-1469s1c1
Sequence:CCGGCCTGACAATGTCGATGATATTCTCGAGAATATCATCGACATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006108.1-827s1c1
Sequence:CCGGGCCAAGTACAGACTCACATTTCTCGAGAAATGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-1417s1c1
Sequence:CCGGCAGAGTTGTCATCGAGAGAATCTCGAGATTCTCTCGATGACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-2147s1c1
Sequence:CCGGGCAGAACTTGGAGACTGCAATCTCGAGATTGCAGTCTCCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006108
VALIDATED
SPON1 MISSION shRNA shRNA Plasmid DNA
spondin 1, extracellular matrix protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006108.2-3014s21c1
Sequence:CCGGGCTGGATTATTTGCTTGTTTACTCGAGTAAACAAGCAAATAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1793s21c1
Sequence:CCGGCCTGACAATGTCGATGATATTCTCGAGAATATCATCGACATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1741s21c1
Sequence:CCGGCAGAGTTGTCATCGAGAGAATCTCGAGATTCTCTCGATGACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1151s21c1
Sequence:CCGGGCCAAGTACAGACTCACATTTCTCGAGAAATGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006108.1-2690s1c1
Sequence:CCGGGCTGGATTATTTGCTTGTTTACTCGAGTAAACAAGCAAATAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-1469s1c1
Sequence:CCGGCCTGACAATGTCGATGATATTCTCGAGAATATCATCGACATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006108.1-827s1c1
Sequence:CCGGGCCAAGTACAGACTCACATTTCTCGAGAAATGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-1417s1c1
Sequence:CCGGCAGAGTTGTCATCGAGAGAATCTCGAGATTCTCTCGATGACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-2147s1c1
Sequence:CCGGGCAGAACTTGGAGACTGCAATCTCGAGATTGCAGTCTCCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006108
VALIDATED
SPON1 MISSION shRNA Lentiviral Transduction Particles
spondin 1, extracellular matrix protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006108.2-3014s21c1
Sequence:CCGGGCTGGATTATTTGCTTGTTTACTCGAGTAAACAAGCAAATAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1793s21c1
Sequence:CCGGCCTGACAATGTCGATGATATTCTCGAGAATATCATCGACATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1741s21c1
Sequence:CCGGCAGAGTTGTCATCGAGAGAATCTCGAGATTCTCTCGATGACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006108.2-1151s21c1
Sequence:CCGGGCCAAGTACAGACTCACATTTCTCGAGAAATGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006108.1-2690s1c1
Sequence:CCGGGCTGGATTATTTGCTTGTTTACTCGAGTAAACAAGCAAATAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-1469s1c1
Sequence:CCGGCCTGACAATGTCGATGATATTCTCGAGAATATCATCGACATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006108.1-827s1c1
Sequence:CCGGGCCAAGTACAGACTCACATTTCTCGAGAAATGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-1417s1c1
Sequence:CCGGCAGAGTTGTCATCGAGAGAATCTCGAGATTCTCTCGATGACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006108.1-2147s1c1
Sequence:CCGGGCAGAACTTGGAGACTGCAATCTCGAGATTGCAGTCTCCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145584
SPON1 MISSION shRNA Bacterial Glycerol Stock
spondin 1, extracellular matrix protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145584.1-3218s1c1
Sequence:CCGGGCAGGTGATGATGGCTACTTTCTCGAGAAAGTAGCCATCATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-814s1c1
Sequence:CCGGGCCAAGTACAGACTCACGTTTCTCGAGAAACGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-1284s1c1
Sequence:CCGGGACCTATGAGTCACCAAACAACTCGAGTTGTTTGGTGACTCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-2529s1c1
Sequence:CCGGGCGCTACATGACTGTGAAGAACTCGAGTTCTTCACAGTCATGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-1281s1c1
Sequence:CCGGCGTGACCTATGAGTCACCAAACTCGAGTTTGGTGACTCATAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145584
SPON1 MISSION shRNA shRNA Plasmid DNA
spondin 1, extracellular matrix protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145584.1-3218s1c1
Sequence:CCGGGCAGGTGATGATGGCTACTTTCTCGAGAAAGTAGCCATCATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-814s1c1
Sequence:CCGGGCCAAGTACAGACTCACGTTTCTCGAGAAACGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-1284s1c1
Sequence:CCGGGACCTATGAGTCACCAAACAACTCGAGTTGTTTGGTGACTCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-2529s1c1
Sequence:CCGGGCGCTACATGACTGTGAAGAACTCGAGTTCTTCACAGTCATGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-1281s1c1
Sequence:CCGGCGTGACCTATGAGTCACCAAACTCGAGTTTGGTGACTCATAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145584
SPON1 MISSION shRNA Lentiviral Transduction Particles
spondin 1, extracellular matrix protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145584.1-3218s1c1
Sequence:CCGGGCAGGTGATGATGGCTACTTTCTCGAGAAAGTAGCCATCATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-814s1c1
Sequence:CCGGGCCAAGTACAGACTCACGTTTCTCGAGAAACGTGAGTCTGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-1284s1c1
Sequence:CCGGGACCTATGAGTCACCAAACAACTCGAGTTGTTTGGTGACTCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-2529s1c1
Sequence:CCGGGCGCTACATGACTGTGAAGAACTCGAGTTCTTCACAGTCATGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145584.1-1281s1c1
Sequence:CCGGCGTGACCTATGAGTCACCAAACTCGAGTTTGGTGACTCATAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks