EMAIL THIS PAGE TO A FRIEND

SPON2

spondin 2, extracellular matrix protein

Synonyms: DIL-1 DIL1 M-SPONDIN MINDIN
UniProtKB ID: Q9BUD6, Q4W5N4, Q9ULW1
Gene ID:
Mouse(100689) spondin 2, extracellular matrix protein
Rat(171569) spondin 2, extracellular matrix protein
chicken(422905) spondin 2, extracellular matrix protein
domestic cat(101081629) spondin 2, extracellular matrix protein
cow(513844) spondin 2, extracellular matrix protein
sheep(101105160) spondin 2, extracellular matrix protein
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502021 Anti-SPON2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat, canine
ELISA, western blot pricing
SAB2501336 Anti-SPON2 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat, bovine
ELISA, western blot pricing
SAB1406987 Anti-SPON2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV52336 Anti-SPON2 antibody produced in rabbit affinity isolated antibody , human, guinea pig, mouse, zebrafish, horse, rat, bovine
western blot pricing
HPA040170 Anti-SPON2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA043890 Anti-SPON2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA066095 Anti-SPON2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2103350 Anti-SPON2, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, human, mouse, guinea pig, rat, zebrafish, horse
western blot pricing
WH0010417M1 Monoclonal Anti-SPON2 antibody produced in mouse clone 3C6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003481 MISSION® esiRNA esiRNA targeting mouse Spon2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128325 Rosetta Predictions human pricing
NM_012445 Rosetta Predictions human pricing
NM_138533 Rosetta Predictions rat pricing
XM_579649 Rosetta Predictions rat pricing
NM_133903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331096 predicted 377
2 SASI_Hs02_00331097 predicted 1033
3 SASI_Hs02_00331098 predicted 490
4 SASI_Hs02_00331099 predicted 1511
5 SASI_Hs02_00331100 predicted 1224
6 SASI_Hs02_00331101 predicted 1534
7 SASI_Hs02_00331102 predicted 1228
8 SASI_Hs02_00331103 predicted 477
9 SASI_Hs02_00331104 predicted 1216
10 SASI_Hs02_00331105 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207643 predicted 399
2 SASI_Hs01_00207644 predicted 1047
3 SASI_Hs01_00207645 predicted 516
4 SASI_Hs01_00207646 predicted 1538
5 SASI_Hs01_00207647 predicted 1247
6 SASI_Hs01_00207648 predicted 1250
7 SASI_Hs01_00207649 predicted 497
8 SASI_Hs01_00207650 predicted 1234
9 SASI_Hs01_00207651 predicted 990
10 SASI_Hs01_00207652 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268165 predicted 1423
2 SASI_Rn01_00085954 predicted 1236
3 SASI_Rn02_00268166 predicted 1407
4 SASI_Rn01_00085956 predicted 1107
5 SASI_Rn01_00085957 predicted 534
6 SASI_Rn01_00085958 predicted 1325
7 SASI_Rn01_00085960 predicted 318
8 SASI_Rn02_00268167 predicted 1106
9 SASI_Rn02_00268168 predicted 1331
10 SASI_Rn01_00085961 predicted 1311
11 SASI_Rn01_00085952 predicted 1732
12 SASI_Rn01_00085953 predicted 1743
13 SASI_Rn01_00085955 predicted 1734
14 SASI_Rn01_00085959 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128739 predicted 425
2 SASI_Rn01_00128740 predicted 47
3 SASI_Rn01_00128741 predicted 269
4 SASI_Rn01_00128742 predicted 1156
5 SASI_Rn01_00128743 predicted 1197
6 SASI_Rn01_00128744 predicted 842
7 SASI_Rn01_00128745 predicted 650
8 SASI_Rn01_00128746 predicted 787
9 SASI_Rn01_00128747 predicted 625
10 SASI_Rn01_00128748 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020011 predicted 1472
2 SASI_Mm01_00020012 predicted 569
3 SASI_Mm01_00020013 predicted 1462
4 SASI_Mm01_00020015 predicted 1570
5 SASI_Mm01_00020016 predicted 1139
6 SASI_Mm01_00020017 predicted 487
7 SASI_Mm01_00020018 predicted 348
8 SASI_Mm01_00020019 predicted 772
9 SASI_Mm01_00020020 predicted 1218
10 SASI_Mm02_00338956 predicted 515
11 SASI_Mm01_00020014 predicted 1465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012445
SPON2 MISSION shRNA Bacterial Glycerol Stock
spondin 2, extracellular matrix protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012445.1-1556s1c1
Sequence:CCGGCTCTAAATTATGGTCTCCTTACTCGAGTAAGGAGACCATAATTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-394s1c1
Sequence:CCGGCGGCCAAATACAGCATCACCTCTCGAGAGGTGATGCTGTATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-1250s1c1
Sequence:CCGGCGTCCCTGATAACTGCGTCTACTCGAGTAGACGCAGTTATCAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-1055s1c1
Sequence:CCGGCAGGGACAATGAGATTGTAGACTCGAGTCTACAATCTCATTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-512s1c1
Sequence:CCGGCGACTACAGCATGTGGAGGAACTCGAGTTCCTCCACATGCTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012445.2-942s21c1
Sequence:CCGGTGACCGAGATAACGTCCTCCTCTCGAGAGGAGGACGTTATCTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012445.2-1582s21c1
Sequence:CCGGCAAGGCTCCAGCTACTCTAAACTCGAGTTTAGAGTAGCTGGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012445.2-1605s21c1
Sequence:CCGGATGTCTCCTTATAAGTTATTGCTCGAGCAATAACTTATAAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012445
SPON2 MISSION shRNA shRNA Plasmid DNA
spondin 2, extracellular matrix protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012445.1-1556s1c1
Sequence:CCGGCTCTAAATTATGGTCTCCTTACTCGAGTAAGGAGACCATAATTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-394s1c1
Sequence:CCGGCGGCCAAATACAGCATCACCTCTCGAGAGGTGATGCTGTATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-1250s1c1
Sequence:CCGGCGTCCCTGATAACTGCGTCTACTCGAGTAGACGCAGTTATCAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-1055s1c1
Sequence:CCGGCAGGGACAATGAGATTGTAGACTCGAGTCTACAATCTCATTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-512s1c1
Sequence:CCGGCGACTACAGCATGTGGAGGAACTCGAGTTCCTCCACATGCTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012445.2-942s21c1
Sequence:CCGGTGACCGAGATAACGTCCTCCTCTCGAGAGGAGGACGTTATCTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012445.2-1582s21c1
Sequence:CCGGCAAGGCTCCAGCTACTCTAAACTCGAGTTTAGAGTAGCTGGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012445.2-1605s21c1
Sequence:CCGGATGTCTCCTTATAAGTTATTGCTCGAGCAATAACTTATAAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012445
SPON2 MISSION shRNA Lentiviral Transduction Particles
spondin 2, extracellular matrix protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012445.1-1556s1c1
Sequence:CCGGCTCTAAATTATGGTCTCCTTACTCGAGTAAGGAGACCATAATTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-394s1c1
Sequence:CCGGCGGCCAAATACAGCATCACCTCTCGAGAGGTGATGCTGTATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-1250s1c1
Sequence:CCGGCGTCCCTGATAACTGCGTCTACTCGAGTAGACGCAGTTATCAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-1055s1c1
Sequence:CCGGCAGGGACAATGAGATTGTAGACTCGAGTCTACAATCTCATTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012445.1-512s1c1
Sequence:CCGGCGACTACAGCATGTGGAGGAACTCGAGTTCCTCCACATGCTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012445.2-942s21c1
Sequence:CCGGTGACCGAGATAACGTCCTCCTCTCGAGAGGAGGACGTTATCTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012445.2-1582s21c1
Sequence:CCGGCAAGGCTCCAGCTACTCTAAACTCGAGTTTAGAGTAGCTGGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012445.2-1605s21c1
Sequence:CCGGATGTCTCCTTATAAGTTATTGCTCGAGCAATAACTTATAAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133903
VALIDATED
SPON2 MISSION shRNA Bacterial Glycerol Stock
spondin 2, extracellular matrix protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-1456s1c1
Sequence:CCGGCGTGGGTTTGATCTACATAAACTCGAGTTTATGTAGATCAAACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133903.2-896s1c1
Sequence:CCGGCCCAGCAAATTCATTCTACTACTCGAGTAGTAGAATGAATTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133903.2-780s1c1
Sequence:CCGGCTGGATCTTTATCCACACGATCTCGAGATCGTGTGGATAAAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-635s1c1
Sequence:CCGGCGGGCAGACTTCCACAGAGTTCTCGAGAACTCTGTGGAAGTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-549s1c1
Sequence:CCGGGCACTGATGAAGGAGATCGAACTCGAGTTCGATCTCCTTCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-412s21c1
Sequence:CCGGGCTAGATACAGCATCACTTTCCTCGAGGAAAGTGATGCTGTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-1511s21c1
Sequence:CCGGCGTGGGTTTGATCTACATAAACTCGAGTTTATGTAGATCAAACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-690s21c1
Sequence:CCGGCGGGCAGACTTCCACAGAGTTCTCGAGAACTCTGTGGAAGTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-1269s21c1
Sequence:CCGGCCCAGATAACTGCGTCTAAACCTCGAGGTTTAGACGCAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133903
VALIDATED
SPON2 MISSION shRNA shRNA Plasmid DNA
spondin 2, extracellular matrix protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-1456s1c1
Sequence:CCGGCGTGGGTTTGATCTACATAAACTCGAGTTTATGTAGATCAAACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133903.2-896s1c1
Sequence:CCGGCCCAGCAAATTCATTCTACTACTCGAGTAGTAGAATGAATTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133903.2-780s1c1
Sequence:CCGGCTGGATCTTTATCCACACGATCTCGAGATCGTGTGGATAAAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-635s1c1
Sequence:CCGGCGGGCAGACTTCCACAGAGTTCTCGAGAACTCTGTGGAAGTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-549s1c1
Sequence:CCGGGCACTGATGAAGGAGATCGAACTCGAGTTCGATCTCCTTCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-412s21c1
Sequence:CCGGGCTAGATACAGCATCACTTTCCTCGAGGAAAGTGATGCTGTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-1511s21c1
Sequence:CCGGCGTGGGTTTGATCTACATAAACTCGAGTTTATGTAGATCAAACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-690s21c1
Sequence:CCGGCGGGCAGACTTCCACAGAGTTCTCGAGAACTCTGTGGAAGTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-1269s21c1
Sequence:CCGGCCCAGATAACTGCGTCTAAACCTCGAGGTTTAGACGCAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133903
VALIDATED
SPON2 MISSION shRNA Lentiviral Transduction Particles
spondin 2, extracellular matrix protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-1456s1c1
Sequence:CCGGCGTGGGTTTGATCTACATAAACTCGAGTTTATGTAGATCAAACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133903.2-896s1c1
Sequence:CCGGCCCAGCAAATTCATTCTACTACTCGAGTAGTAGAATGAATTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133903.2-780s1c1
Sequence:CCGGCTGGATCTTTATCCACACGATCTCGAGATCGTGTGGATAAAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-635s1c1
Sequence:CCGGCGGGCAGACTTCCACAGAGTTCTCGAGAACTCTGTGGAAGTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133903.2-549s1c1
Sequence:CCGGGCACTGATGAAGGAGATCGAACTCGAGTTCGATCTCCTTCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-412s21c1
Sequence:CCGGGCTAGATACAGCATCACTTTCCTCGAGGAAAGTGATGCTGTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-1511s21c1
Sequence:CCGGCGTGGGTTTGATCTACATAAACTCGAGTTTATGTAGATCAAACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-690s21c1
Sequence:CCGGCGGGCAGACTTCCACAGAGTTCTCGAGAACTCTGTGGAAGTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133903.3-1269s21c1
Sequence:CCGGCCCAGATAACTGCGTCTAAACCTCGAGGTTTAGACGCAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks