EMAIL THIS PAGE TO A FRIEND

SPOP

speckle-type POZ protein

Synonyms: BTBD32 TEF2
UniProtKB ID: O43791, B2R6S3, D3DTW7, Q53HJ1
Gene ID:
Human(8405) Summary: This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(20747) speckle-type POZ protein
Rat(287643) speckle-type POZ protein
Zebrafish(100005514) speckle-type POZ protein
chicken(425528) speckle-type POZ protein
dog(480548) speckle-type POZ protein
domestic cat(101094712) speckle-type POZ protein
Horse(100056116) speckle-type POZ protein
domestic guinea pig(100713182) speckle-type POZ protein
naked mole-rat(101725604) speckle-type POZ protein
Domestic Rabbit(100343929) speckle-type POZ protein
cow(530618) speckle-type POZ protein
sheep(101111300) speckle-type POZ protein
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003563 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007226 Rosetta Predictions human pricing
NM_001007227 Rosetta Predictions human pricing
NM_001007228 Rosetta Predictions human pricing
NM_001007229 Rosetta Predictions human pricing
NM_001007230 Rosetta Predictions human pricing
NM_003563 Rosetta Predictions human pricing
NM_001100496 Rosetta Predictions rat pricing
NM_025287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034099 predicted 603
2 SASI_Hs01_00034100 predicted 969
3 SASI_Hs01_00034101 predicted 664
4 SASI_Hs01_00034102 predicted 640
5 SASI_Hs01_00034103 predicted 1314
6 SASI_Hs01_00034104 predicted 1596
7 SASI_Hs01_00034105 predicted 715
8 SASI_Hs01_00034106 predicted 602
9 SASI_Hs01_00034107 predicted 1440
10 SASI_Hs01_00034108 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081047 predicted 484
2 SASI_Hs01_00081048 predicted 850
3 SASI_Hs01_00081049 predicted 539
4 SASI_Hs01_00081050 predicted 526
5 SASI_Hs01_00081051 predicted 1193
6 SASI_Hs01_00081052 predicted 1472
7 SASI_Hs01_00081053 predicted 595
8 SASI_Hs01_00081054 predicted 485
9 SASI_Hs01_00081055 predicted 1316
10 SASI_Hs01_00081056 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233241 predicted 428
2 SASI_Hs01_00233242 predicted 798
3 SASI_Hs01_00233243 predicted 490
4 SASI_Hs01_00233244 predicted 467
5 SASI_Hs01_00233245 predicted 1144
6 SASI_Hs01_00233246 predicted 1423
7 SASI_Hs01_00233247 predicted 547
8 SASI_Hs01_00233248 predicted 430
9 SASI_Hs01_00233249 predicted 1262
10 SASI_Hs01_00233250 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182533 predicted 483
2 SASI_Hs01_00182534 predicted 848
3 SASI_Hs01_00182535 predicted 534
4 SASI_Hs01_00182536 predicted 526
5 SASI_Hs01_00182537 predicted 1196
6 SASI_Hs01_00182538 predicted 1476
7 SASI_Hs01_00182539 predicted 595
8 SASI_Hs01_00182540 predicted 480
9 SASI_Hs01_00182541 predicted 1319
10 SASI_Hs01_00182542 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140734 predicted 532
2 SASI_Hs01_00140735 predicted 901
3 SASI_Hs01_00140736 predicted 585
4 SASI_Hs01_00140737 predicted 570
5 SASI_Hs01_00140738 predicted 1249
6 SASI_Hs01_00140739 predicted 1530
7 SASI_Hs01_00140740 predicted 648
8 SASI_Hs01_00140741 predicted 535
9 SASI_Hs01_00140742 predicted 1371
10 SASI_Hs01_00140743 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143140 predicted 548
2 SASI_Hs01_00143141 predicted 912
3 SASI_Hs01_00143142 predicted 608
4 SASI_Hs01_00143143 predicted 596
5 SASI_Hs01_00143144 predicted 1265
6 SASI_Hs01_00143145 predicted 1544
7 SASI_Hs01_00143146 predicted 672
8 SASI_Hs01_00143147 predicted 556
9 SASI_Hs01_00143148 predicted 1392
10 SASI_Hs01_00143149 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209894 predicted 511
2 SASI_Rn02_00209895 predicted 1189
3 SASI_Rn02_00209896 predicted 702
4 SASI_Rn02_00209897 predicted 800
5 SASI_Rn02_00209898 predicted 1007
6 SASI_Rn02_00209899 predicted 297
7 SASI_Rn02_00209900 predicted 251
8 SASI_Rn02_00209901 predicted 915
9 SASI_Rn02_00209902 predicted 227
10 SASI_Rn02_00209903 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085331 predicted 549
2 SASI_Mm01_00085332 predicted 379
3 SASI_Mm01_00085333 predicted 475
4 SASI_Mm01_00085335 predicted 437
5 SASI_Mm01_00085336 predicted 673
6 SASI_Mm01_00085337 predicted 282
7 SASI_Mm01_00085338 predicted 672
8 SASI_Mm01_00085339 predicted 730
9 SASI_Mm02_00327902 predicted 1123
10 SASI_Mm01_00085340 predicted 420
11 SASI_Mm01_00085334 predicted 1493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025287
VALIDATED
SPOP MISSION shRNA Bacterial Glycerol Stock
speckle-type POZ protein
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-539s21c1
Sequence:CCGGGGAGAGTCAGCGAGCTTATAGCTCGAGCTATAAGCTCGCTGACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-383s21c1
Sequence:CCGGGAAATGGTGTTTGCGAGTAAACTCGAGTTTACTCGCAAACACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-359s21c1
Sequence:CCGGTTCATCAGGAGCCAATGATAACTCGAGTTATCATTGGCTCCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-678s21c1
Sequence:CCGGGTACAAGACTCTGTCAATATTCTCGAGAATATTGACAGAGTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-922s21c1
Sequence:CCGGACGTGGAGCCTGAGGTGTTTACTCGAGTAAACACCTCAGGCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-292s21c1
Sequence:CCGGTGTGGACCATCAATAACTTTACTCGAGTAAAGTTATTGATGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-1585s1c1
Sequence:CCGGGCAGTGGTACTTCGGAGAAATCTCGAGATTTCTCCGAAGTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025287.1-519s1c1
Sequence:CCGGCGAGCTTATAGGTTCGTGCAACTCGAGTTGCACGAACCTATAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-369s1c1
Sequence:CCGGGTAAACCCGAAAGGGCTAGATCTCGAGATCTAGCCCTTTCGGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-1267s1c1
Sequence:CCGGCGCTTGAAGCAATCCTAAGATCTCGAGATCTTAGGATTGCTTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025287.1-407s1c1
Sequence:CCGGCCTGTCGCTTTACCTGTTGTTCTCGAGAACAACAGGTAAAGCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025287
VALIDATED
SPOP MISSION shRNA shRNA Plasmid DNA
speckle-type POZ protein
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-539s21c1
Sequence:CCGGGGAGAGTCAGCGAGCTTATAGCTCGAGCTATAAGCTCGCTGACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-383s21c1
Sequence:CCGGGAAATGGTGTTTGCGAGTAAACTCGAGTTTACTCGCAAACACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-359s21c1
Sequence:CCGGTTCATCAGGAGCCAATGATAACTCGAGTTATCATTGGCTCCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-678s21c1
Sequence:CCGGGTACAAGACTCTGTCAATATTCTCGAGAATATTGACAGAGTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-922s21c1
Sequence:CCGGACGTGGAGCCTGAGGTGTTTACTCGAGTAAACACCTCAGGCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-292s21c1
Sequence:CCGGTGTGGACCATCAATAACTTTACTCGAGTAAAGTTATTGATGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-1585s1c1
Sequence:CCGGGCAGTGGTACTTCGGAGAAATCTCGAGATTTCTCCGAAGTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025287.1-519s1c1
Sequence:CCGGCGAGCTTATAGGTTCGTGCAACTCGAGTTGCACGAACCTATAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-369s1c1
Sequence:CCGGGTAAACCCGAAAGGGCTAGATCTCGAGATCTAGCCCTTTCGGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-1267s1c1
Sequence:CCGGCGCTTGAAGCAATCCTAAGATCTCGAGATCTTAGGATTGCTTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025287.1-407s1c1
Sequence:CCGGCCTGTCGCTTTACCTGTTGTTCTCGAGAACAACAGGTAAAGCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025287
VALIDATED
SPOP MISSION shRNA Lentiviral Transduction Particles
speckle-type POZ protein
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-539s21c1
Sequence:CCGGGGAGAGTCAGCGAGCTTATAGCTCGAGCTATAAGCTCGCTGACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-383s21c1
Sequence:CCGGGAAATGGTGTTTGCGAGTAAACTCGAGTTTACTCGCAAACACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-359s21c1
Sequence:CCGGTTCATCAGGAGCCAATGATAACTCGAGTTATCATTGGCTCCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-678s21c1
Sequence:CCGGGTACAAGACTCTGTCAATATTCTCGAGAATATTGACAGAGTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-922s21c1
Sequence:CCGGACGTGGAGCCTGAGGTGTTTACTCGAGTAAACACCTCAGGCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025287.2-292s21c1
Sequence:CCGGTGTGGACCATCAATAACTTTACTCGAGTAAAGTTATTGATGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-1585s1c1
Sequence:CCGGGCAGTGGTACTTCGGAGAAATCTCGAGATTTCTCCGAAGTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025287.1-519s1c1
Sequence:CCGGCGAGCTTATAGGTTCGTGCAACTCGAGTTGCACGAACCTATAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-369s1c1
Sequence:CCGGGTAAACCCGAAAGGGCTAGATCTCGAGATCTAGCCCTTTCGGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025287.1-1267s1c1
Sequence:CCGGCGCTTGAAGCAATCCTAAGATCTCGAGATCTTAGGATTGCTTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025287.1-407s1c1
Sequence:CCGGCCTGTCGCTTTACCTGTTGTTCTCGAGAACAACAGGTAAAGCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003563
VALIDATED
SPOP MISSION shRNA Bacterial Glycerol Stock
speckle-type POZ protein
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-897s21c1
Sequence:CCGGGAGGTGAGTGTTGTGCAAGATCTCGAGATCTTGCACAACACTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-515s21c1
Sequence:CCGGCTCCTACATGTGGACCATCAACTCGAGTTGATGGTCCACATGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-493s21c1
Sequence:CCGGCACAGATCAAGGTAGTGAAATCTCGAGATTTCACTACCTTGATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-1059s21c1
Sequence:CCGGCACAAGGCTATCTTAGCAGCTCTCGAGAGCTGCTAAGATAGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003563.2-698s1c1
Sequence:CCGGGATTCAAGAAATTCATCCGTACTCGAGTACGGATGAATTTCTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003563.2-822s1c1
Sequence:CCGGGAATACCATGAACATGGTAAACTCGAGTTTACCATGTTCATGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-1152s1c1
Sequence:CCGGGCGCTTAAAGGTCATGTGTGACTCGAGTCACACATGACCTTTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003563.2-1407s1c1
Sequence:CCGGCAAACGCCTGAAGCAATCCTACTCGAGTAGGATTGCTTCAGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-584s1c1
Sequence:CCGGCAAAGAGTGAAGTTCGGGCAACTCGAGTTGCCCGAACTTCACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-943s1c1
Sequence:CCGGCACAAGGCTATCTTAGCAGCTCTCGAGAGCTGCTAAGATAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-399s1c1
Sequence:CCGGCTCCTACATGTGGACCATCAACTCGAGTTGATGGTCCACATGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-863s1c1
Sequence:CCGGCAGATGAGTTAGGAGGACTGTCTCGAGACAGTCCTCCTAACTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-384s1c1
Sequence:CCGGCAAGGTAGTGAAATTCTCCTACTCGAGTAGGAGAATTTCACTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-1264s1c1
Sequence:CCGGGCAGTGGATTTCATCAACTATCTCGAGATAGTTGATGAAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003563.2-377s1c1
Sequence:CCGGCACAGATCAAGGTAGTGAAATCTCGAGATTTCACTACCTTGATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003563
VALIDATED
SPOP MISSION shRNA shRNA Plasmid DNA
speckle-type POZ protein
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-897s21c1
Sequence:CCGGGAGGTGAGTGTTGTGCAAGATCTCGAGATCTTGCACAACACTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-515s21c1
Sequence:CCGGCTCCTACATGTGGACCATCAACTCGAGTTGATGGTCCACATGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-493s21c1
Sequence:CCGGCACAGATCAAGGTAGTGAAATCTCGAGATTTCACTACCTTGATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-1059s21c1
Sequence:CCGGCACAAGGCTATCTTAGCAGCTCTCGAGAGCTGCTAAGATAGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003563.2-698s1c1
Sequence:CCGGGATTCAAGAAATTCATCCGTACTCGAGTACGGATGAATTTCTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003563.2-822s1c1
Sequence:CCGGGAATACCATGAACATGGTAAACTCGAGTTTACCATGTTCATGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-1152s1c1
Sequence:CCGGGCGCTTAAAGGTCATGTGTGACTCGAGTCACACATGACCTTTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003563.2-1407s1c1
Sequence:CCGGCAAACGCCTGAAGCAATCCTACTCGAGTAGGATTGCTTCAGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-584s1c1
Sequence:CCGGCAAAGAGTGAAGTTCGGGCAACTCGAGTTGCCCGAACTTCACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-943s1c1
Sequence:CCGGCACAAGGCTATCTTAGCAGCTCTCGAGAGCTGCTAAGATAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-399s1c1
Sequence:CCGGCTCCTACATGTGGACCATCAACTCGAGTTGATGGTCCACATGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-863s1c1
Sequence:CCGGCAGATGAGTTAGGAGGACTGTCTCGAGACAGTCCTCCTAACTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-384s1c1
Sequence:CCGGCAAGGTAGTGAAATTCTCCTACTCGAGTAGGAGAATTTCACTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-1264s1c1
Sequence:CCGGGCAGTGGATTTCATCAACTATCTCGAGATAGTTGATGAAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003563.2-377s1c1
Sequence:CCGGCACAGATCAAGGTAGTGAAATCTCGAGATTTCACTACCTTGATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003563
VALIDATED
SPOP MISSION shRNA Lentiviral Transduction Particles
speckle-type POZ protein
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-897s21c1
Sequence:CCGGGAGGTGAGTGTTGTGCAAGATCTCGAGATCTTGCACAACACTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-515s21c1
Sequence:CCGGCTCCTACATGTGGACCATCAACTCGAGTTGATGGTCCACATGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-493s21c1
Sequence:CCGGCACAGATCAAGGTAGTGAAATCTCGAGATTTCACTACCTTGATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003563.3-1059s21c1
Sequence:CCGGCACAAGGCTATCTTAGCAGCTCTCGAGAGCTGCTAAGATAGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003563.2-698s1c1
Sequence:CCGGGATTCAAGAAATTCATCCGTACTCGAGTACGGATGAATTTCTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003563.2-822s1c1
Sequence:CCGGGAATACCATGAACATGGTAAACTCGAGTTTACCATGTTCATGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-1152s1c1
Sequence:CCGGGCGCTTAAAGGTCATGTGTGACTCGAGTCACACATGACCTTTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003563.2-1407s1c1
Sequence:CCGGCAAACGCCTGAAGCAATCCTACTCGAGTAGGATTGCTTCAGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-584s1c1
Sequence:CCGGCAAAGAGTGAAGTTCGGGCAACTCGAGTTGCCCGAACTTCACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-943s1c1
Sequence:CCGGCACAAGGCTATCTTAGCAGCTCTCGAGAGCTGCTAAGATAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-399s1c1
Sequence:CCGGCTCCTACATGTGGACCATCAACTCGAGTTGATGGTCCACATGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-863s1c1
Sequence:CCGGCAGATGAGTTAGGAGGACTGTCTCGAGACAGTCCTCCTAACTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003563.2-384s1c1
Sequence:CCGGCAAGGTAGTGAAATTCTCCTACTCGAGTAGGAGAATTTCACTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003563.2-1264s1c1
Sequence:CCGGGCAGTGGATTTCATCAACTATCTCGAGATAGTTGATGAAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003563.2-377s1c1
Sequence:CCGGCACAGATCAAGGTAGTGAAATCTCGAGATTTCACTACCTTGATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks