EMAIL THIS PAGE TO A FRIEND

SPOPL

speckle-type POZ protein-like

Synonyms: BTBD33
UniProtKB ID: Q6IQ16
Gene ID:
Mouse(76857) speckle-type POZ protein-like
Rat(296532) speckle-type POZ protein-like
cow(510817) speckle-type POZ protein-like
sheep(101102622) speckle-type POZ protein-like
Domestic Rabbit(100348644) speckle-type POZ protein-like
naked mole-rat(101703641) speckle-type POZ protein-like
domestic guinea pig(100730410) speckle-type POZ protein-like
chicken(424299) speckle-type POZ protein-like
dog(476134) speckle-type POZ protein-like
Horse(100056551) speckle-type POZ protein-like
domestic cat(101094691) speckle-type POZ protein-like
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50314 Anti-SPOPL antibody produced in rabbit affinity isolated antibody human, zebrafish, horse, bovine, guinea pig, canine, mouse, rat, rabbit
western blot pricing
SAB2103683 Anti-SPOPL antibody produced in rabbit affinity isolated antibody canine, human, guinea pig, rabbit, horse, bovine, mouse, rat, zebrafish
western blot pricing
HPA034687 Anti-SPOPL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001664 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376144 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001664 Rosetta Predictions human pricing
NM_001134447 Rosetta Predictions rat pricing
NM_029773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114596 predicted 1527
2 SASI_Hs01_00114597 predicted 965
3 SASI_Hs01_00114598 predicted 475
4 SASI_Hs02_00303862 predicted 1000
5 SASI_Hs01_00114599 predicted 1244
6 SASI_Hs01_00114600 predicted 1271
7 SASI_Hs01_00114601 predicted 438
8 SASI_Hs01_00114602 predicted 1244
9 SASI_Hs01_00114603 predicted 1312
10 SASI_Hs01_00114604 predicted 439
11 SASI_Hs01_00114605 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256349 predicted 387
2 SASI_Rn02_00256350 predicted 358
3 SASI_Rn02_00256351 predicted 1191
4 SASI_Rn02_00256352 predicted 610
5 SASI_Rn02_00256353 predicted 1020
6 SASI_Rn02_00256354 predicted 916
7 SASI_Rn02_00256355 predicted 204
8 SASI_Rn02_00256356 predicted 513
9 SASI_Rn02_00256357 predicted 688
10 SASI_Rn02_00256358 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048956 predicted 1408
2 SASI_Mm01_00048957 predicted 720
3 SASI_Mm01_00048958 predicted 1133
4 SASI_Mm01_00048959 predicted 485
5 SASI_Mm01_00048960 predicted 331
6 SASI_Mm01_00048961 predicted 1030
7 SASI_Mm01_00048962 predicted 624
8 SASI_Mm01_00048963 predicted 1025
9 SASI_Mm01_00048964 predicted 520
10 SASI_Mm01_00048965 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001664
SPOPL MISSION shRNA Bacterial Glycerol Stock
speckle-type POZ protein-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-830s1c1
Sequence:CCGGCCAGATGACAAGCTTACATTACTCGAGTAATGTAAGCTTGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001664.1-4408s1c1
Sequence:CCGGCCTTGAATAGTCATGTGTCATCTCGAGATGACACATGACTATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-1419s1c1
Sequence:CCGGCAACCGACATAATGGAAACATCTCGAGATGTTTCCATTATGTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-596s1c1
Sequence:CCGGCCAAAGGGATTAGATGATGAACTCGAGTTCATCATCTAATCCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001664.1-1418s1c1
Sequence:CCGGGCAACCGACATAATGGAAACACTCGAGTGTTTCCATTATGTCGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001664.1-1520s1c1
Sequence:CCGGCAGTTTGGCATTCCACGCAAACTCGAGTTTGCGTGGAATGCCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-1373s1c1
Sequence:CCGGCGACAACTTGGGTGTAAAGATCTCGAGATCTTTACACCCAAGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001664
SPOPL MISSION shRNA shRNA Plasmid DNA
speckle-type POZ protein-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-830s1c1
Sequence:CCGGCCAGATGACAAGCTTACATTACTCGAGTAATGTAAGCTTGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001664.1-4408s1c1
Sequence:CCGGCCTTGAATAGTCATGTGTCATCTCGAGATGACACATGACTATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-1419s1c1
Sequence:CCGGCAACCGACATAATGGAAACATCTCGAGATGTTTCCATTATGTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-596s1c1
Sequence:CCGGCCAAAGGGATTAGATGATGAACTCGAGTTCATCATCTAATCCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001664.1-1418s1c1
Sequence:CCGGGCAACCGACATAATGGAAACACTCGAGTGTTTCCATTATGTCGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001664.1-1520s1c1
Sequence:CCGGCAGTTTGGCATTCCACGCAAACTCGAGTTTGCGTGGAATGCCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-1373s1c1
Sequence:CCGGCGACAACTTGGGTGTAAAGATCTCGAGATCTTTACACCCAAGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001664
SPOPL MISSION shRNA Lentiviral Transduction Particles
speckle-type POZ protein-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-830s1c1
Sequence:CCGGCCAGATGACAAGCTTACATTACTCGAGTAATGTAAGCTTGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001664.1-4408s1c1
Sequence:CCGGCCTTGAATAGTCATGTGTCATCTCGAGATGACACATGACTATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-1419s1c1
Sequence:CCGGCAACCGACATAATGGAAACATCTCGAGATGTTTCCATTATGTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-596s1c1
Sequence:CCGGCCAAAGGGATTAGATGATGAACTCGAGTTCATCATCTAATCCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001664.1-1418s1c1
Sequence:CCGGGCAACCGACATAATGGAAACACTCGAGTGTTTCCATTATGTCGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001664.1-1520s1c1
Sequence:CCGGCAGTTTGGCATTCCACGCAAACTCGAGTTTGCGTGGAATGCCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001664.1-1373s1c1
Sequence:CCGGCGACAACTTGGGTGTAAAGATCTCGAGATCTTTACACCCAAGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376144
SPOPL MISSION shRNA Bacterial Glycerol Stock
speckle-type POZ protein-like
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000122773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376144.1-556s1c1
Sequence:CCGGCAGTTGAAAGCACAAGCCATACTCGAGTATGGCTTGTGCTTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376144.1-460s1c1
Sequence:CCGGCGGCTGAAGGTCATGTGCGAACTCGAGTTCGCACATGACCTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376144.1-2597s1c1
Sequence:CCGGCCTGTCTTCATTACTTTCTATCTCGAGATAGAAAGTAATGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_376144.1-2504s1c1
Sequence:CCGGCCAGATTCATTTGGATTCATACTCGAGTATGAATCCAAATGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376144
SPOPL MISSION shRNA shRNA Plasmid DNA
speckle-type POZ protein-like
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000122773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376144.1-556s1c1
Sequence:CCGGCAGTTGAAAGCACAAGCCATACTCGAGTATGGCTTGTGCTTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376144.1-460s1c1
Sequence:CCGGCGGCTGAAGGTCATGTGCGAACTCGAGTTCGCACATGACCTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376144.1-2597s1c1
Sequence:CCGGCCTGTCTTCATTACTTTCTATCTCGAGATAGAAAGTAATGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_376144.1-2504s1c1
Sequence:CCGGCCAGATTCATTTGGATTCATACTCGAGTATGAATCCAAATGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376144
SPOPL MISSION shRNA Lentiviral Transduction Particles
speckle-type POZ protein-like
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000122773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376144.1-556s1c1
Sequence:CCGGCAGTTGAAAGCACAAGCCATACTCGAGTATGGCTTGTGCTTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376144.1-460s1c1
Sequence:CCGGCGGCTGAAGGTCATGTGCGAACTCGAGTTCGCACATGACCTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376144.1-2597s1c1
Sequence:CCGGCCTGTCTTCATTACTTTCTATCTCGAGATAGAAAGTAATGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_376144.1-2504s1c1
Sequence:CCGGCCAGATTCATTTGGATTCATACTCGAGTATGAATCCAAATGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029773
VALIDATED
SPOPL MISSION shRNA Bacterial Glycerol Stock
speckle-type POZ protein-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029773.1-1496s1c1
Sequence:CCGGCCCGAAGGATTCCAATACAAACTCGAGTTTGTATTGGAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-1099s1c1
Sequence:CCGGGCAGACAAATATGCACTGGAACTCGAGTTCCAGTGCATATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029773.1-1402s1c1
Sequence:CCGGCAGTGTCCACAGTTTGGTATTCTCGAGAATACCAAACTGTGGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-332s1c1
Sequence:CCGGGCTGGTGTTACACACAGGTTACTCGAGTAACCTGTGTGTAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-977s1c1
Sequence:CCGGGCACAAAGAATCGAGTGGAAACTCGAGTTTCCACTCGATTCTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029773
VALIDATED
SPOPL MISSION shRNA shRNA Plasmid DNA
speckle-type POZ protein-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029773.1-1496s1c1
Sequence:CCGGCCCGAAGGATTCCAATACAAACTCGAGTTTGTATTGGAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-1099s1c1
Sequence:CCGGGCAGACAAATATGCACTGGAACTCGAGTTCCAGTGCATATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029773.1-1402s1c1
Sequence:CCGGCAGTGTCCACAGTTTGGTATTCTCGAGAATACCAAACTGTGGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-332s1c1
Sequence:CCGGGCTGGTGTTACACACAGGTTACTCGAGTAACCTGTGTGTAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-977s1c1
Sequence:CCGGGCACAAAGAATCGAGTGGAAACTCGAGTTTCCACTCGATTCTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029773
VALIDATED
SPOPL MISSION shRNA Lentiviral Transduction Particles
speckle-type POZ protein-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029773.1-1496s1c1
Sequence:CCGGCCCGAAGGATTCCAATACAAACTCGAGTTTGTATTGGAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-1099s1c1
Sequence:CCGGGCAGACAAATATGCACTGGAACTCGAGTTCCAGTGCATATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029773.1-1402s1c1
Sequence:CCGGCAGTGTCCACAGTTTGGTATTCTCGAGAATACCAAACTGTGGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-332s1c1
Sequence:CCGGGCTGGTGTTACACACAGGTTACTCGAGTAACCTGTGTGTAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029773.1-977s1c1
Sequence:CCGGGCACAAAGAATCGAGTGGAAACTCGAGTTTCCACTCGATTCTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks