EMAIL THIS PAGE TO A FRIEND

SPP1

secreted phosphoprotein 1

Synonyms: BNSP BSPI ETA-1 OPN
Gene ID:
Human(6696) Summary: The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(20750) secreted phosphoprotein 1
Rat(25353) secreted phosphoprotein 1
Thale Cress(841567) sucrose-phosphatase 1
chicken(395210) secreted phosphoprotein 1
dog(478471) secreted phosphoprotein 1
domestic cat(101094264) secreted phosphoprotein 1
Zebrafish(432385) secreted phosphoprotein 1
domestic guinea pig(100715233) secreted phosphoprotein 1
naked mole-rat(101726269) secreted phosphoprotein 1
Domestic Rabbit(100008982) secreted phosphoprotein 1
cow(281499) secreted phosphoprotein 1
sheep(443058) secreted phosphoprotein 1
Goat(100860805) secreted phosphoprotein 1
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306579 ANTI-OPN-A/B(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
O7635 Anti-Osteopontin antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, immunohistochemistry, neutralization, western blot pricing
O3389 Anti-Osteopontin antibody produced in goat affinity isolated antibody, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
O7264 Anti-Osteopontin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4502841 Anti-Osteopontin, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB2500729 Anti-Osteopontin/SPP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
AV36677 Anti-SPP1 antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, canine, pig, bovine, rat, human
immunohistochemistry, western blot pricing
HPA027541 Anti-SPP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing
SAB2104323 Anti-SPP1, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, mouse, horse, rabbit, canine, guinea pig, human
western blot pricing
SAB4200018 Monoclonal Anti-Osteopontin antibody produced in mouse ~1.0 mg/mL, clone OPN46, purified immunoglobulin, buffered aqueous solution monkey, mouse, rat, human, canine
western blot pricing
WH0006696M1 Monoclonal Anti-SPP1 antibody produced in mouse clone 1E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404404 Monoclonal Anti-SPP1 antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0901 AQUA Peptide GDSLAYGL[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000582 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000582 Rosetta Predictions human pricing
NM_001040058 Rosetta Predictions human pricing
NM_001040060 Rosetta Predictions human pricing
NM_012881 Rosetta Predictions rat pricing
NM_009263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174866 predicted 706
2 SASI_Hs01_00174867 predicted 1191
3 SASI_Hs01_00174868 predicted 1007
4 SASI_Hs01_00174869 predicted 1241
5 SASI_Hs01_00174870 predicted 930
6 SASI_Hs01_00174871 predicted 1176
7 SASI_Hs02_00302843 predicted 1237
8 SASI_Hs02_00302844 predicted 1335
9 SASI_Hs01_00174872 predicted 843
10 SASI_Hs02_00302845 predicted 1329
11 SASI_Hs01_00174873 predicted 868
12 SASI_Hs01_00174874 predicted 1091
13 SASI_Hs01_00174875 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117408 predicted 745
2 SASI_Hs01_00117409 predicted 1237
3 SASI_Hs01_00117410 predicted 1052
4 SASI_Hs01_00117411 predicted 1276
5 SASI_Hs01_00117412 predicted 968
6 SASI_Hs01_00117413 predicted 1220
7 SASI_Hs01_00117414 predicted 644
8 SASI_Hs02_00308778 predicted 1277
9 SASI_Hs02_00308779 predicted 1375
10 SASI_Hs01_00117415 predicted 886
11 SASI_Hs01_00117416 predicted 909
12 SASI_Hs01_00117417 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127528 predicted 668
2 SASI_Hs01_00127529 predicted 1154
3 SASI_Hs01_00127530 predicted 974
4 SASI_Hs01_00127531 predicted 1194
5 SASI_Hs01_00127532 predicted 893
6 SASI_Hs01_00127533 predicted 1134
7 SASI_Hs02_00308782 predicted 1197
8 SASI_Hs02_00308783 predicted 1295
9 SASI_Hs01_00127534 predicted 804
10 SASI_Hs02_00308784 predicted 1295
11 SASI_Hs01_00127535 predicted 831
12 SASI_Hs01_00127536 predicted 1054
13 SASI_Hs01_00127537 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119292 predicted 658
2 SASI_Rn01_00119293 predicted 420
3 SASI_Rn02_00260390 predicted 990
4 SASI_Rn02_00260391 predicted 209
5 SASI_Rn01_00119294 predicted 1108
6 SASI_Rn01_00119296 predicted 1079
7 SASI_Rn01_00119297 predicted 431
8 SASI_Rn01_00119298 predicted 1143
9 SASI_Rn01_00119299 predicted 338
10 SASI_Rn02_00260392 predicted 1000
11 SASI_Rn01_00119295 predicted 544
12 SASI_Rn01_00119300 predicted 987
13 SASI_Rn01_00119301 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052292 predicted 1042
2 SASI_Mm01_00052293 predicted 994
3 SASI_Mm01_00052294 predicted 407
4 SASI_Mm01_00052295 predicted 1071
5 SASI_Mm01_00052296 predicted 312
6 SASI_Mm01_00052297 predicted 1045
7 SASI_Mm01_00052298 predicted 295
8 SASI_Mm01_00052299 predicted 618
9 SASI_Mm01_00052300 predicted 393
10 SASI_Mm01_00052301 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009263
VALIDATED
SPP1 MISSION shRNA Bacterial Glycerol Stock
secreted phosphoprotein 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009263.1-1251s1c1
Sequence:CCGGCTCTTAGCTTAGTCTGTTGTTCTCGAGAACAACAGACTAAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-593s1c1
Sequence:CCGGCTAGTACACAAGCAGACACTTCTCGAGAAGTGTCTGCTTGTGTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009263.1-416s1c1
Sequence:CCGGAGGATGACTTTAAGCAAGAAACTCGAGTTTCTTGCTTAAAGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-1003s1c1
Sequence:CCGGCACAAGGACAAGCTAGTCCTACTCGAGTAGGACTAGCTTGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009263.1-1178s1c1
Sequence:CCGGGCAGGAATACTAACTGCTCATCTCGAGATGAGCAGTTAGTATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009263.1-678s1c1
Sequence:CCGGGAGGTCAAAGTCTAGGAGTTTCTCGAGAAACTCCTAGACTTTGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-536s1c1
Sequence:CCGGACTCGGATGAATCTGACGAATCTCGAGATTCGTCAGATTCATCCGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-272s1c1
Sequence:CCGGTCCCGGTGAAAGTGACTGATTCTCGAGAATCAGTCACTTTCACCGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-1027s1c1
Sequence:CCGGCCTAAGAGTAAGGAAGATGATCTCGAGATCATCTTCCTTACTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-919s21c1
Sequence:CCGGAGGTATCTGAAATTCCGAATTCTCGAGAATTCGGAATTTCAGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-874s21c1
Sequence:CCGGCACAAGGACAAGCTAGTCCTACTCGAGTAGGACTAGCTTGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-549s21c1
Sequence:CCGGGAGGTCAAAGTCTAGGAGTTTCTCGAGAAACTCCTAGACTTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009263.2-1049s21c1
Sequence:CCGGGCAGGAATACTAACTGCTCATCTCGAGATGAGCAGTTAGTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-287s21c1
Sequence:CCGGAGGATGACTTTAAGCAAGAAACTCGAGTTTCTTGCTTAAAGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009263.2-1122s21c1
Sequence:CCGGCTCTTAGCTTAGTCTGTTGTTCTCGAGAACAACAGACTAAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009263
VALIDATED
SPP1 MISSION shRNA shRNA Plasmid DNA
secreted phosphoprotein 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009263.1-1251s1c1
Sequence:CCGGCTCTTAGCTTAGTCTGTTGTTCTCGAGAACAACAGACTAAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-593s1c1
Sequence:CCGGCTAGTACACAAGCAGACACTTCTCGAGAAGTGTCTGCTTGTGTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009263.1-416s1c1
Sequence:CCGGAGGATGACTTTAAGCAAGAAACTCGAGTTTCTTGCTTAAAGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-1003s1c1
Sequence:CCGGCACAAGGACAAGCTAGTCCTACTCGAGTAGGACTAGCTTGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009263.1-1178s1c1
Sequence:CCGGGCAGGAATACTAACTGCTCATCTCGAGATGAGCAGTTAGTATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009263.1-678s1c1
Sequence:CCGGGAGGTCAAAGTCTAGGAGTTTCTCGAGAAACTCCTAGACTTTGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-536s1c1
Sequence:CCGGACTCGGATGAATCTGACGAATCTCGAGATTCGTCAGATTCATCCGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-272s1c1
Sequence:CCGGTCCCGGTGAAAGTGACTGATTCTCGAGAATCAGTCACTTTCACCGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-1027s1c1
Sequence:CCGGCCTAAGAGTAAGGAAGATGATCTCGAGATCATCTTCCTTACTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-919s21c1
Sequence:CCGGAGGTATCTGAAATTCCGAATTCTCGAGAATTCGGAATTTCAGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-874s21c1
Sequence:CCGGCACAAGGACAAGCTAGTCCTACTCGAGTAGGACTAGCTTGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-549s21c1
Sequence:CCGGGAGGTCAAAGTCTAGGAGTTTCTCGAGAAACTCCTAGACTTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009263.2-1049s21c1
Sequence:CCGGGCAGGAATACTAACTGCTCATCTCGAGATGAGCAGTTAGTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-287s21c1
Sequence:CCGGAGGATGACTTTAAGCAAGAAACTCGAGTTTCTTGCTTAAAGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009263.2-1122s21c1
Sequence:CCGGCTCTTAGCTTAGTCTGTTGTTCTCGAGAACAACAGACTAAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009263
VALIDATED
SPP1 MISSION shRNA Lentiviral Transduction Particles
secreted phosphoprotein 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009263.1-1251s1c1
Sequence:CCGGCTCTTAGCTTAGTCTGTTGTTCTCGAGAACAACAGACTAAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-593s1c1
Sequence:CCGGCTAGTACACAAGCAGACACTTCTCGAGAAGTGTCTGCTTGTGTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009263.1-416s1c1
Sequence:CCGGAGGATGACTTTAAGCAAGAAACTCGAGTTTCTTGCTTAAAGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-1003s1c1
Sequence:CCGGCACAAGGACAAGCTAGTCCTACTCGAGTAGGACTAGCTTGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009263.1-1178s1c1
Sequence:CCGGGCAGGAATACTAACTGCTCATCTCGAGATGAGCAGTTAGTATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009263.1-678s1c1
Sequence:CCGGGAGGTCAAAGTCTAGGAGTTTCTCGAGAAACTCCTAGACTTTGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-536s1c1
Sequence:CCGGACTCGGATGAATCTGACGAATCTCGAGATTCGTCAGATTCATCCGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-272s1c1
Sequence:CCGGTCCCGGTGAAAGTGACTGATTCTCGAGAATCAGTCACTTTCACCGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009263.1-1027s1c1
Sequence:CCGGCCTAAGAGTAAGGAAGATGATCTCGAGATCATCTTCCTTACTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-919s21c1
Sequence:CCGGAGGTATCTGAAATTCCGAATTCTCGAGAATTCGGAATTTCAGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-874s21c1
Sequence:CCGGCACAAGGACAAGCTAGTCCTACTCGAGTAGGACTAGCTTGTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-549s21c1
Sequence:CCGGGAGGTCAAAGTCTAGGAGTTTCTCGAGAAACTCCTAGACTTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009263.2-1049s21c1
Sequence:CCGGGCAGGAATACTAACTGCTCATCTCGAGATGAGCAGTTAGTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009263.2-287s21c1
Sequence:CCGGAGGATGACTTTAAGCAAGAAACTCGAGTTTCTTGCTTAAAGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009263.2-1122s21c1
Sequence:CCGGCTCTTAGCTTAGTCTGTTGTTCTCGAGAACAACAGACTAAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000582
SPP1 MISSION shRNA Bacterial Glycerol Stock
secreted phosphoprotein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000582.2-259s1c1
Sequence:CCGGCTTTACAACAAATACCCAGATCTCGAGATCTGGGTATTTGTTGTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000582.2-597s1c1
Sequence:CCGGCCGAGGTGATAGTGTGGTTTACTCGAGTAAACCACACTATCACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000582.2-708s21c1
Sequence:CCGGCGAGGAGTTGAATGGTGCATACTCGAGTATGCACCATTCAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000582.2-1265s21c1
Sequence:CCGGCTTCAGGGTTATGTCTATGTTCTCGAGAACATAGACATAACCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000582.2-259s21c1
Sequence:CCGGCTTTACAACAAATACCCAGATCTCGAGATCTGGGTATTTGTTGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000582
SPP1 MISSION shRNA shRNA Plasmid DNA
secreted phosphoprotein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000582.2-259s1c1
Sequence:CCGGCTTTACAACAAATACCCAGATCTCGAGATCTGGGTATTTGTTGTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000582.2-597s1c1
Sequence:CCGGCCGAGGTGATAGTGTGGTTTACTCGAGTAAACCACACTATCACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000582.2-708s21c1
Sequence:CCGGCGAGGAGTTGAATGGTGCATACTCGAGTATGCACCATTCAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000582.2-1265s21c1
Sequence:CCGGCTTCAGGGTTATGTCTATGTTCTCGAGAACATAGACATAACCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000582.2-259s21c1
Sequence:CCGGCTTTACAACAAATACCCAGATCTCGAGATCTGGGTATTTGTTGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000582
SPP1 MISSION shRNA Lentiviral Transduction Particles
secreted phosphoprotein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000582.2-259s1c1
Sequence:CCGGCTTTACAACAAATACCCAGATCTCGAGATCTGGGTATTTGTTGTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000582.2-597s1c1
Sequence:CCGGCCGAGGTGATAGTGTGGTTTACTCGAGTAAACCACACTATCACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000582.2-708s21c1
Sequence:CCGGCGAGGAGTTGAATGGTGCATACTCGAGTATGCACCATTCAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000582.2-1265s21c1
Sequence:CCGGCTTCAGGGTTATGTCTATGTTCTCGAGAACATAGACATAACCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000582.2-259s21c1
Sequence:CCGGCTTTACAACAAATACCCAGATCTCGAGATCTGGGTATTTGTTGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks