EMAIL THIS PAGE TO A FRIEND

SPP2

secreted phosphoprotein 2, 24kDa

Synonyms: SPP-24 SPP24
UniProtKB ID: Q13103, A4QMV3, Q3B892, Q546M5
Gene ID:
Human(6694) Summary: This gene encodes a secreted phosphoprotein that is a member of the cystatin superfamily. [provided by RefSeq, Oct 2008]
Mouse(75396) secreted phosphoprotein 2
Rat(94168) secreted phosphoprotein 2
cow(281500) secreted phosphoprotein 2, 24kDa
sheep(443510) secreted phosphoprotein 2, 24kDa
naked mole-rat(101710197) secreted phosphoprotein 2, 24kDa
domestic guinea pig(100718327) secreted phosphoprotein 2, 24kDa
Thale Cress(824399) sucrose-phosphatase 2
chicken(396080) secreted phosphoprotein 2, 24kDa
dog(610394) secreted phosphoprotein 2, 24kDa
domestic cat(101101496) secreted phosphoprotein 2, 24kDa
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006944 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006944 Rosetta Predictions human pricing
NM_053577 Rosetta Predictions rat pricing
XM_001065906 Rosetta Predictions rat pricing
NM_029269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087479 predicted 790
2 SASI_Hs01_00087480 predicted 314
3 SASI_Hs01_00087481 predicted 709
4 SASI_Hs01_00087482 predicted 642
5 SASI_Hs01_00087483 predicted 383
6 SASI_Hs01_00087484 predicted 533
7 SASI_Hs01_00087486 predicted 598
8 SASI_Hs01_00087487 predicted 287
9 SASI_Hs01_00087488 predicted 313
10 SASI_Hs02_00342659 predicted 539
11 SASI_Hs01_00087485 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079861 predicted 363
2 SASI_Rn01_00079862 predicted 288
3 SASI_Rn02_00266244 predicted 362
4 SASI_Rn02_00266245 predicted 282
5 SASI_Rn01_00079863 predicted 361
6 SASI_Rn01_00079865 predicted 256
7 SASI_Rn01_00079867 predicted 217
8 SASI_Rn01_00079868 predicted 500
9 SASI_Rn01_00079869 predicted 638
10 SASI_Rn02_00266246 predicted 634
11 SASI_Rn01_00079864 predicted 217
12 SASI_Rn01_00079866 predicted 360
13 SASI_Rn01_00079870 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315703 predicted 355
2 SASI_Rn02_00315704 predicted 278
3 SASI_Rn02_00315705 predicted 350
4 SASI_Rn02_00315706 predicted 283
5 SASI_Rn02_00315707 predicted 363
6 SASI_Rn02_00315708 predicted 254
7 SASI_Rn02_00315709 predicted 561
8 SASI_Rn02_00315710 predicted 209
9 SASI_Rn02_00315711 predicted 550
10 SASI_Rn02_00315712 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118472 predicted 466
2 SASI_Mm02_00335045 predicted 313
3 SASI_Mm01_00118473 predicted 574
4 SASI_Mm02_00335046 predicted 342
5 SASI_Mm01_00118474 predicted 350
6 SASI_Mm01_00118475 predicted 578
7 SASI_Mm01_00118476 predicted 339
8 SASI_Mm01_00118477 predicted 339
9 SASI_Mm02_00335047 predicted 314
10 SASI_Mm01_00118479 predicted 487
11 SASI_Mm01_00118478 predicted 386
12 SASI_Mm01_00118480 predicted 568
13 SASI_Mm01_00118481 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029269
SPP2 MISSION shRNA Bacterial Glycerol Stock
secreted phosphoprotein 2, 24kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-718s1c1
Sequence:CCGGGCAAGAGTAAATTCTGGCTTTCTCGAGAAAGCCAGAATTTACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-579s1c1
Sequence:CCGGCCACAGACGAAGAAATGATTACTCGAGTAATCATTTCTTCGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-580s1c1
Sequence:CCGGCACAGACGAAGAAATGATTATCTCGAGATAATCATTTCTTCGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-379s1c1
Sequence:CCGGGAAACCACATGCCTGAGAGATCTCGAGATCTCTCAGGCATGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-684s1c1
Sequence:CCGGCGCCCATAGAAGGTTCCTGAACTCGAGTTCAGGAACCTTCTATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029269
SPP2 MISSION shRNA shRNA Plasmid DNA
secreted phosphoprotein 2, 24kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-718s1c1
Sequence:CCGGGCAAGAGTAAATTCTGGCTTTCTCGAGAAAGCCAGAATTTACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-579s1c1
Sequence:CCGGCCACAGACGAAGAAATGATTACTCGAGTAATCATTTCTTCGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-580s1c1
Sequence:CCGGCACAGACGAAGAAATGATTATCTCGAGATAATCATTTCTTCGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-379s1c1
Sequence:CCGGGAAACCACATGCCTGAGAGATCTCGAGATCTCTCAGGCATGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-684s1c1
Sequence:CCGGCGCCCATAGAAGGTTCCTGAACTCGAGTTCAGGAACCTTCTATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029269
SPP2 MISSION shRNA Lentiviral Transduction Particles
secreted phosphoprotein 2, 24kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-718s1c1
Sequence:CCGGGCAAGAGTAAATTCTGGCTTTCTCGAGAAAGCCAGAATTTACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-579s1c1
Sequence:CCGGCCACAGACGAAGAAATGATTACTCGAGTAATCATTTCTTCGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-580s1c1
Sequence:CCGGCACAGACGAAGAAATGATTATCTCGAGATAATCATTTCTTCGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-379s1c1
Sequence:CCGGGAAACCACATGCCTGAGAGATCTCGAGATCTCTCAGGCATGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029269.1-684s1c1
Sequence:CCGGCGCCCATAGAAGGTTCCTGAACTCGAGTTCAGGAACCTTCTATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006944
SPP2 MISSION shRNA Bacterial Glycerol Stock
secreted phosphoprotein 2, 24kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-100s1c1
Sequence:CCGGGACTACGATCCATCCTCCTTACTCGAGTAAGGAGGATGGATCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-231s1c1
Sequence:CCGGCAACTTGGTCATGAATTTAGACTCGAGTCTAAATTCATGACCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-467s1c1
Sequence:CCGGGATCTCATAAATGGAGAAACACTCGAGTGTTTCTCCATTTATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-457s1c1
Sequence:CCGGGACATGTTGGGATCTCATAAACTCGAGTTTATGAGATCCCAACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-45s1c1
Sequence:CCGGGATTATGTTTGCTCTTGGAATCTCGAGATTCCAAGAGCAAACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-62s1c1
Sequence:CCGGGAATGAACTACTGGTCTTGCTCTCGAGAGCAAGACCAGTAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-56s1c1
Sequence:CCGGCTCTTGGAATGAACTACTGGTCTCGAGACCAGTAGTTCATTCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-426s1c1
Sequence:CCGGGTCTTACAGCAGCGAAGAGATCTCGAGATCTCTTCGCTGCTGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-162s1c1
Sequence:CCGGGTCACTGAGTCCGTATCTGTTCTCGAGAACAGATACGGACTCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-106s1c1
Sequence:CCGGGATCCATCCTCCTTAAGGGATCTCGAGATCCCTTAAGGAGGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006944
SPP2 MISSION shRNA shRNA Plasmid DNA
secreted phosphoprotein 2, 24kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-100s1c1
Sequence:CCGGGACTACGATCCATCCTCCTTACTCGAGTAAGGAGGATGGATCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-231s1c1
Sequence:CCGGCAACTTGGTCATGAATTTAGACTCGAGTCTAAATTCATGACCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-467s1c1
Sequence:CCGGGATCTCATAAATGGAGAAACACTCGAGTGTTTCTCCATTTATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-457s1c1
Sequence:CCGGGACATGTTGGGATCTCATAAACTCGAGTTTATGAGATCCCAACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-45s1c1
Sequence:CCGGGATTATGTTTGCTCTTGGAATCTCGAGATTCCAAGAGCAAACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-62s1c1
Sequence:CCGGGAATGAACTACTGGTCTTGCTCTCGAGAGCAAGACCAGTAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-56s1c1
Sequence:CCGGCTCTTGGAATGAACTACTGGTCTCGAGACCAGTAGTTCATTCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-426s1c1
Sequence:CCGGGTCTTACAGCAGCGAAGAGATCTCGAGATCTCTTCGCTGCTGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-162s1c1
Sequence:CCGGGTCACTGAGTCCGTATCTGTTCTCGAGAACAGATACGGACTCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-106s1c1
Sequence:CCGGGATCCATCCTCCTTAAGGGATCTCGAGATCCCTTAAGGAGGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006944
SPP2 MISSION shRNA Lentiviral Transduction Particles
secreted phosphoprotein 2, 24kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-100s1c1
Sequence:CCGGGACTACGATCCATCCTCCTTACTCGAGTAAGGAGGATGGATCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-231s1c1
Sequence:CCGGCAACTTGGTCATGAATTTAGACTCGAGTCTAAATTCATGACCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-467s1c1
Sequence:CCGGGATCTCATAAATGGAGAAACACTCGAGTGTTTCTCCATTTATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-457s1c1
Sequence:CCGGGACATGTTGGGATCTCATAAACTCGAGTTTATGAGATCCCAACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006944.1-45s1c1
Sequence:CCGGGATTATGTTTGCTCTTGGAATCTCGAGATTCCAAGAGCAAACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-62s1c1
Sequence:CCGGGAATGAACTACTGGTCTTGCTCTCGAGAGCAAGACCAGTAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-56s1c1
Sequence:CCGGCTCTTGGAATGAACTACTGGTCTCGAGACCAGTAGTTCATTCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-426s1c1
Sequence:CCGGGTCTTACAGCAGCGAAGAGATCTCGAGATCTCTTCGCTGCTGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-162s1c1
Sequence:CCGGGTCACTGAGTCCGTATCTGTTCTCGAGAACAGATACGGACTCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006944.1-106s1c1
Sequence:CCGGGATCCATCCTCCTTAAGGGATCTCGAGATCCCTTAAGGAGGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks