EMAIL THIS PAGE TO A FRIEND

SPPL2A

signal peptide peptidase like 2A

Synonyms: IMP3 PSL2
UniProtKB ID: Q8TCT8, B2RDS0, Q8TAW1, Q96SZ8
Gene ID:
Human(84888) Summary: This gene encodes a member of the GXGD family of aspartic proteases, which are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions, as well as a member of the signal peptide peptidase-like protease (SPPL) family. This protein is expressed in all major adult human tissues and localizes to late endosomal compartments and lysosomal membranes. A pseudogene of this gene also lies on chromosome 15. [provided by RefSeq, Feb 2012]
Mouse(66552) signal peptide peptidase like 2A
Rat(311401) signal peptide peptidase-like 2A
chicken(415450) signal peptide peptidase like 2A
dog(478301) signal peptide peptidase like 2A
domestic cat(101083341) signal peptide peptidase like 2A
domestic guinea pig(100716831) signal peptide peptidase like 2A
naked mole-rat(101708930) signal peptide peptidase like 2A
cow(530325) signal peptide peptidase like 2A
sheep(101108055) signal peptide peptidase like 2A
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032802 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119571 MISSION® esiRNA esiRNA human AC012100.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032802 Rosetta Predictions human pricing
NM_001107770 Rosetta Predictions rat pricing
NM_023220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147712 predicted 831
2 SASI_Hs01_00147714 predicted 1481
3 SASI_Hs01_00147715 predicted 936
4 SASI_Hs01_00147716 predicted 1350
5 SASI_Hs02_00360363 predicted 841
6 SASI_Hs01_00147717 predicted 1381
7 SASI_Hs01_00147719 predicted 1584
8 SASI_Hs02_00360364 predicted 432
9 SASI_Hs01_00147720 predicted 1259
10 SASI_Hs01_00147721 predicted 258
11 SASI_Hs01_00147713 predicted 833
12 SASI_Hs01_00147718 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232095 predicted 419
2 SASI_Rn02_00232096 predicted 1410
3 SASI_Rn02_00232097 predicted 862
4 SASI_Rn02_00232098 predicted 1242
5 SASI_Rn02_00232099 predicted 772
6 SASI_Rn02_00232100 predicted 340
7 SASI_Rn02_00232101 predicted 1383
8 SASI_Rn02_00232102 predicted 1572
9 SASI_Rn02_00232103 predicted 720
10 SASI_Rn02_00232104 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032624 predicted 1224
2 SASI_Mm02_00326975 predicted 552
3 SASI_Mm01_00032626 predicted 632
4 SASI_Mm01_00032627 predicted 922
5 SASI_Mm01_00032628 predicted 1453
6 SASI_Mm01_00032629 predicted 1248
7 SASI_Mm01_00032630 predicted 1014
8 SASI_Mm01_00032631 predicted 1487
9 SASI_Mm01_00032632 predicted 343
10 SASI_Mm02_00326976 predicted 730
11 SASI_Mm01_00032623 predicted 1347
12 SASI_Mm01_00032625 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032802
VALIDATED
SPPL2A MISSION shRNA Bacterial Glycerol Stock
signal peptide peptidase like 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032802.2-1743s1c1
Sequence:CCGGCTACAAATAGACTTCGACTTTCTCGAGAAAGTCGAAGTCTATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-349s1c1
Sequence:CCGGCCACACCACTATGCAACCTTTCTCGAGAAAGGTTGCATAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1470s1c1
Sequence:CCGGGCCTATGCTATTGGCATGATACTCGAGTATCATGCCAATAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1625s1c1
Sequence:CCGGCTATCAGATGATGGACCATTTCTCGAGAAATGGTCCATCATCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1393s1c1
Sequence:CCGGGCCTGTTGATTGCATACTGTACTCGAGTACAGTATGCAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-524s21c1
Sequence:CCGGTCAATAACAGTGTCCTATTTCCTCGAGGAAATAGGACACTGTTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-834s21c1
Sequence:CCGGTAGTCCTCTTACAGTTGTAATCTCGAGATTACAACTGTAAGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-1084s21c1
Sequence:CCGGGTTTGGGCTGTGTTTCGAAATCTCGAGATTTCGAAACACAGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032802
VALIDATED
SPPL2A MISSION shRNA shRNA Plasmid DNA
signal peptide peptidase like 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032802.2-1743s1c1
Sequence:CCGGCTACAAATAGACTTCGACTTTCTCGAGAAAGTCGAAGTCTATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-349s1c1
Sequence:CCGGCCACACCACTATGCAACCTTTCTCGAGAAAGGTTGCATAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1470s1c1
Sequence:CCGGGCCTATGCTATTGGCATGATACTCGAGTATCATGCCAATAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1625s1c1
Sequence:CCGGCTATCAGATGATGGACCATTTCTCGAGAAATGGTCCATCATCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1393s1c1
Sequence:CCGGGCCTGTTGATTGCATACTGTACTCGAGTACAGTATGCAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-524s21c1
Sequence:CCGGTCAATAACAGTGTCCTATTTCCTCGAGGAAATAGGACACTGTTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-834s21c1
Sequence:CCGGTAGTCCTCTTACAGTTGTAATCTCGAGATTACAACTGTAAGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-1084s21c1
Sequence:CCGGGTTTGGGCTGTGTTTCGAAATCTCGAGATTTCGAAACACAGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032802
VALIDATED
SPPL2A MISSION shRNA Lentiviral Transduction Particles
signal peptide peptidase like 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032802.2-1743s1c1
Sequence:CCGGCTACAAATAGACTTCGACTTTCTCGAGAAAGTCGAAGTCTATTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-349s1c1
Sequence:CCGGCCACACCACTATGCAACCTTTCTCGAGAAAGGTTGCATAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1470s1c1
Sequence:CCGGGCCTATGCTATTGGCATGATACTCGAGTATCATGCCAATAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1625s1c1
Sequence:CCGGCTATCAGATGATGGACCATTTCTCGAGAAATGGTCCATCATCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032802.2-1393s1c1
Sequence:CCGGGCCTGTTGATTGCATACTGTACTCGAGTACAGTATGCAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-524s21c1
Sequence:CCGGTCAATAACAGTGTCCTATTTCCTCGAGGAAATAGGACACTGTTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-834s21c1
Sequence:CCGGTAGTCCTCTTACAGTTGTAATCTCGAGATTACAACTGTAAGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032802.3-1084s21c1
Sequence:CCGGGTTTGGGCTGTGTTTCGAAATCTCGAGATTTCGAAACACAGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023220
VALIDATED
SPPL2A MISSION shRNA Bacterial Glycerol Stock
signal peptide peptidase like 2A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-1485s1c1
Sequence:CCGGGCCTGTTGATTGCATATTGTACTCGAGTACAATATGCAATCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-723s1c1
Sequence:CCGGCCTGGCCTAACTTTGACTATACTCGAGTATAGTCAAAGTTAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-1444s1c1
Sequence:CCGGGCCTGTTTCAGTATTGGGTTTCTCGAGAAACCCAATACTGAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-913s1c1
Sequence:CCGGCGTGGTCATCTGCTGTATAATCTCGAGATTATACAGCAGATGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-318s1c1
Sequence:CCGGCGTCTACAAATGGCGTGTCTTCTCGAGAAGACACGCCATTTGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-1485s21c1
Sequence:CCGGGCCTGTTGATTGCATATTGTACTCGAGTACAATATGCAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-1444s21c1
Sequence:CCGGGCCTGTTTCAGTATTGGGTTTCTCGAGAAACCCAATACTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-913s21c1
Sequence:CCGGCGTGGTCATCTGCTGTATAATCTCGAGATTATACAGCAGATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-723s21c1
Sequence:CCGGCCTGGCCTAACTTTGACTATACTCGAGTATAGTCAAAGTTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023220
VALIDATED
SPPL2A MISSION shRNA shRNA Plasmid DNA
signal peptide peptidase like 2A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-1485s1c1
Sequence:CCGGGCCTGTTGATTGCATATTGTACTCGAGTACAATATGCAATCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-723s1c1
Sequence:CCGGCCTGGCCTAACTTTGACTATACTCGAGTATAGTCAAAGTTAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-1444s1c1
Sequence:CCGGGCCTGTTTCAGTATTGGGTTTCTCGAGAAACCCAATACTGAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-913s1c1
Sequence:CCGGCGTGGTCATCTGCTGTATAATCTCGAGATTATACAGCAGATGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-318s1c1
Sequence:CCGGCGTCTACAAATGGCGTGTCTTCTCGAGAAGACACGCCATTTGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-1485s21c1
Sequence:CCGGGCCTGTTGATTGCATATTGTACTCGAGTACAATATGCAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-1444s21c1
Sequence:CCGGGCCTGTTTCAGTATTGGGTTTCTCGAGAAACCCAATACTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-913s21c1
Sequence:CCGGCGTGGTCATCTGCTGTATAATCTCGAGATTATACAGCAGATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-723s21c1
Sequence:CCGGCCTGGCCTAACTTTGACTATACTCGAGTATAGTCAAAGTTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023220
VALIDATED
SPPL2A MISSION shRNA Lentiviral Transduction Particles
signal peptide peptidase like 2A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-1485s1c1
Sequence:CCGGGCCTGTTGATTGCATATTGTACTCGAGTACAATATGCAATCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-723s1c1
Sequence:CCGGCCTGGCCTAACTTTGACTATACTCGAGTATAGTCAAAGTTAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-1444s1c1
Sequence:CCGGGCCTGTTTCAGTATTGGGTTTCTCGAGAAACCCAATACTGAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-913s1c1
Sequence:CCGGCGTGGTCATCTGCTGTATAATCTCGAGATTATACAGCAGATGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023220.1-318s1c1
Sequence:CCGGCGTCTACAAATGGCGTGTCTTCTCGAGAAGACACGCCATTTGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-1485s21c1
Sequence:CCGGGCCTGTTGATTGCATATTGTACTCGAGTACAATATGCAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-1444s21c1
Sequence:CCGGGCCTGTTTCAGTATTGGGTTTCTCGAGAAACCCAATACTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-913s21c1
Sequence:CCGGCGTGGTCATCTGCTGTATAATCTCGAGATTATACAGCAGATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023220.1-723s21c1
Sequence:CCGGCCTGGCCTAACTTTGACTATACTCGAGTATAGTCAAAGTTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks