EMAIL THIS PAGE TO A FRIEND

SPPL2B

signal peptide peptidase like 2B

Synonyms: IMP-4 IMP4 PSH4 PSL1
Gene ID:
Human(56928) Summary: This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(73218) signal peptide peptidase like 2B
Rat(362828) signal peptide peptidase-like 2B
cow(504285) signal peptide peptidase-like 2B
sheep(101120828) signal peptide peptidase like 2B
naked mole-rat(101708060) signal peptide peptidase like 2B
domestic guinea pig(100719910) signal peptide peptidase like 2B
chicken(420056) signal peptide peptidase like 2B
dog(485071) signal peptide peptidase like 2B
domestic cat(101081277) signal peptide peptidase like 2B
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020172 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077238 Rosetta Predictions human pricing
NM_020172 Rosetta Predictions human pricing
NM_152988 Rosetta Predictions human pricing
NM_001014200 Rosetta Predictions rat pricing
NM_175195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312254 predicted 505
2 SASI_Hs02_00312255 predicted 796
3 SASI_Hs02_00312256 predicted 1151
4 SASI_Hs02_00312257 predicted 456
5 SASI_Hs02_00312258 predicted 767
6 SASI_Hs02_00312259 predicted 1131
7 SASI_Hs02_00312260 predicted 1066
8 SASI_Hs02_00312261 predicted 1324
9 SASI_Hs02_00312262 predicted 1012
10 SASI_Hs02_00312263 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013191 predicted 1327
2 SASI_Hs01_00013192 predicted 465
3 SASI_Hs01_00013193 predicted 1387
4 SASI_Hs01_00013194 predicted 417
5 SASI_Hs01_00013195 predicted 1536
6 SASI_Hs01_00013196 predicted 1084
7 SASI_Hs01_00013197 predicted 522
8 SASI_Hs01_00013198 predicted 1134
9 SASI_Hs01_00013199 predicted 473
10 SASI_Hs01_00013200 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243790 predicted 504
2 SASI_Hs02_00366934 predicted 789
3 SASI_Hs02_00366935 predicted 1153
4 SASI_Hs01_00243792 predicted 461
5 SASI_Hs02_00366936 predicted 764
6 SASI_Hs01_00243794 predicted 1134
7 SASI_Hs02_00366937 predicted 1007
8 SASI_Hs01_00243795 predicted 567
9 SASI_Hs02_00366938 predicted 2290
10 SASI_Hs01_00243796 predicted 1185
11 SASI_Hs01_00243789 predicted 1331
12 SASI_Hs01_00243791 predicted 1388
13 SASI_Hs01_00243793 predicted 1543
14 SASI_Hs01_00243797 predicted 480
15 SASI_Hs01_00243798 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090693 predicted 1697
2 SASI_Rn02_00201720 predicted 319
3 SASI_Rn02_00201721 predicted 219
4 SASI_Rn01_00090695 predicted 1377
5 SASI_Rn02_00201722 predicted 452
6 SASI_Rn01_00090696 predicted 1107
7 SASI_Rn01_00090699 predicted 1837
8 SASI_Rn02_00201723 predicted 1000
9 SASI_Rn01_00090701 predicted 1851
10 SASI_Rn01_00090702 predicted 646
11 SASI_Rn01_00090694 predicted 1229
12 SASI_Rn01_00090697 predicted 683
13 SASI_Rn01_00090698 predicted 2214
14 SASI_Rn01_00090700 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345854 predicted 212
2 SASI_Mm01_00153729 predicted 730
3 SASI_Mm01_00153733 predicted 1371
4 SASI_Mm02_00345855 predicted 707
5 SASI_Mm02_00345856 predicted 295
6 SASI_Mm02_00345857 predicted 725
7 SASI_Mm02_00345858 predicted 518
8 SASI_Mm02_00345859 predicted 1643
9 SASI_Mm02_00345860 predicted 421
10 SASI_Mm02_00345861 predicted 438
11 SASI_Mm01_00153730 predicted 766
12 SASI_Mm01_00153731 predicted 742
13 SASI_Mm01_00153732 predicted 1785
14 SASI_Mm01_00153734 predicted 680
15 SASI_Mm01_00153735 predicted 1357
16 SASI_Mm01_00153736 predicted 1178
17 SASI_Mm01_00153737 predicted 721
18 SASI_Mm01_00153738 predicted 1087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175195
VALIDATED
SPPL2B MISSION shRNA Bacterial Glycerol Stock
signal peptide peptidase like 2B
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-1949s21c1
Sequence:CCGGTCTGAGGCCTCAAGTAGATTCCTCGAGGAATCTACTTGAGGCCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-782s21c1
Sequence:CCGGGCCTGGTCTACGTGATCATTGCTCGAGCAATGATCACGTAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-338s21c1
Sequence:CCGGACTGTACCTTCTATGAGAAAGCTCGAGCTTTCTCATAGAAGGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-437s21c1
Sequence:CCGGAGACACAGTATGAGGAGATAACTCGAGTTATCTCCTCATACTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-644s21c1
Sequence:CCGGAGAAGTACATGAAGCATAAGCCTCGAGGCTTATGCTTCATGTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-2138s21c1
Sequence:CCGGCCCAACAAGCAGGTTCCTATGCTCGAGCATAGGAACCTGCTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-521s21c1
Sequence:CCGGAGGTAATGGTGGCACTGTATGCTCGAGCATACAGTGCCACCATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-2220s21c1
Sequence:CCGGAGGAGAGTCCATGCCAAGATGCTCGAGCATCTTGGCATGGACTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-2276s1c1
Sequence:CCGGCCACTGCTCTAAGCCAGTAAACTCGAGTTTACTGGCTTAGAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-1381s1c1
Sequence:CCGGGCAGTCCTCCAGAATTTACTTCTCGAGAAGTAAATTCTGGAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-772s1c1
Sequence:CCGGGCTTGTGCTTCTCTACTACTTCTCGAGAAGTAGTAGAGAAGCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-1352s1c1
Sequence:CCGGGCCTACTGTCACAGGTTTGATCTCGAGATCAAACCTGTGACAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175195.2-731s1c1
Sequence:CCGGCCAGTCATGATCTGCGTGTTTCTCGAGAAACACGCAGATCATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175195
VALIDATED
SPPL2B MISSION shRNA shRNA Plasmid DNA
signal peptide peptidase like 2B
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-1949s21c1
Sequence:CCGGTCTGAGGCCTCAAGTAGATTCCTCGAGGAATCTACTTGAGGCCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-782s21c1
Sequence:CCGGGCCTGGTCTACGTGATCATTGCTCGAGCAATGATCACGTAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-338s21c1
Sequence:CCGGACTGTACCTTCTATGAGAAAGCTCGAGCTTTCTCATAGAAGGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-437s21c1
Sequence:CCGGAGACACAGTATGAGGAGATAACTCGAGTTATCTCCTCATACTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-644s21c1
Sequence:CCGGAGAAGTACATGAAGCATAAGCCTCGAGGCTTATGCTTCATGTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-2138s21c1
Sequence:CCGGCCCAACAAGCAGGTTCCTATGCTCGAGCATAGGAACCTGCTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-521s21c1
Sequence:CCGGAGGTAATGGTGGCACTGTATGCTCGAGCATACAGTGCCACCATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-2220s21c1
Sequence:CCGGAGGAGAGTCCATGCCAAGATGCTCGAGCATCTTGGCATGGACTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-2276s1c1
Sequence:CCGGCCACTGCTCTAAGCCAGTAAACTCGAGTTTACTGGCTTAGAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-1381s1c1
Sequence:CCGGGCAGTCCTCCAGAATTTACTTCTCGAGAAGTAAATTCTGGAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-772s1c1
Sequence:CCGGGCTTGTGCTTCTCTACTACTTCTCGAGAAGTAGTAGAGAAGCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-1352s1c1
Sequence:CCGGGCCTACTGTCACAGGTTTGATCTCGAGATCAAACCTGTGACAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175195.2-731s1c1
Sequence:CCGGCCAGTCATGATCTGCGTGTTTCTCGAGAAACACGCAGATCATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175195
VALIDATED
SPPL2B MISSION shRNA Lentiviral Transduction Particles
signal peptide peptidase like 2B
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-1949s21c1
Sequence:CCGGTCTGAGGCCTCAAGTAGATTCCTCGAGGAATCTACTTGAGGCCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-782s21c1
Sequence:CCGGGCCTGGTCTACGTGATCATTGCTCGAGCAATGATCACGTAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-338s21c1
Sequence:CCGGACTGTACCTTCTATGAGAAAGCTCGAGCTTTCTCATAGAAGGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-437s21c1
Sequence:CCGGAGACACAGTATGAGGAGATAACTCGAGTTATCTCCTCATACTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-644s21c1
Sequence:CCGGAGAAGTACATGAAGCATAAGCCTCGAGGCTTATGCTTCATGTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-2138s21c1
Sequence:CCGGCCCAACAAGCAGGTTCCTATGCTCGAGCATAGGAACCTGCTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175195.3-521s21c1
Sequence:CCGGAGGTAATGGTGGCACTGTATGCTCGAGCATACAGTGCCACCATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175195.3-2220s21c1
Sequence:CCGGAGGAGAGTCCATGCCAAGATGCTCGAGCATCTTGGCATGGACTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-2276s1c1
Sequence:CCGGCCACTGCTCTAAGCCAGTAAACTCGAGTTTACTGGCTTAGAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-1381s1c1
Sequence:CCGGGCAGTCCTCCAGAATTTACTTCTCGAGAAGTAAATTCTGGAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-772s1c1
Sequence:CCGGGCTTGTGCTTCTCTACTACTTCTCGAGAAGTAGTAGAGAAGCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175195.2-1352s1c1
Sequence:CCGGGCCTACTGTCACAGGTTTGATCTCGAGATCAAACCTGTGACAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175195.2-731s1c1
Sequence:CCGGCCAGTCATGATCTGCGTGTTTCTCGAGAAACACGCAGATCATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020172
VALIDATED
SPPL2B MISSION shRNA Bacterial Glycerol Stock
signal peptide peptidase like 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020172.1-421s1c2
Sequence:CCGGCGCAGTATGATGAGATTGGCACTCGAGTGCCAATCTCATCATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020172.1-539s1c1
Sequence:CCGGGCTGGACTACAACATGGTCATCTCGAGATGACCATGTTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-1636s1c1
Sequence:CCGGCCAGCGAAGAACCAGCCACATCTCGAGATGTGGCTGGTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-452s1c1
Sequence:CCGGCCTGCTCAGCTACAAAGACATCTCGAGATGTCTTTGTAGCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-146s1c1
Sequence:CCGGCGAAGGCAAAGACTACTGCATCTCGAGATGCAGTAGTCTTTGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020172
VALIDATED
SPPL2B MISSION shRNA shRNA Plasmid DNA
signal peptide peptidase like 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020172.1-421s1c2
Sequence:CCGGCGCAGTATGATGAGATTGGCACTCGAGTGCCAATCTCATCATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020172.1-539s1c1
Sequence:CCGGGCTGGACTACAACATGGTCATCTCGAGATGACCATGTTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-1636s1c1
Sequence:CCGGCCAGCGAAGAACCAGCCACATCTCGAGATGTGGCTGGTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-452s1c1
Sequence:CCGGCCTGCTCAGCTACAAAGACATCTCGAGATGTCTTTGTAGCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-146s1c1
Sequence:CCGGCGAAGGCAAAGACTACTGCATCTCGAGATGCAGTAGTCTTTGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020172
VALIDATED
SPPL2B MISSION shRNA Lentiviral Transduction Particles
signal peptide peptidase like 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020172.1-421s1c2
Sequence:CCGGCGCAGTATGATGAGATTGGCACTCGAGTGCCAATCTCATCATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020172.1-539s1c1
Sequence:CCGGGCTGGACTACAACATGGTCATCTCGAGATGACCATGTTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-1636s1c1
Sequence:CCGGCCAGCGAAGAACCAGCCACATCTCGAGATGTGGCTGGTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-452s1c1
Sequence:CCGGCCTGCTCAGCTACAAAGACATCTCGAGATGTCTTTGTAGCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020172.1-146s1c1
Sequence:CCGGCGAAGGCAAAGACTACTGCATCTCGAGATGCAGTAGTCTTTGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks